DEAD (Asp-Glu-Ala-Asp) box polypeptide 56

cDNA: Genbank AY648812

 

hi3073 is in the 1st intron

 

cattatatatatatatatatacctgagtctccatatcagattttcgtttc

tcctttgcgatgcaaaagaaagtatactgagtgcttctgggaaacatgca

tacacaatggaaaaaaatgcataaattaaaaaatattagaattaaagaat

tgatgatttgttatgctagctgttttggtcaatgtgtgtgtgtgatattc

acttcctacagcattagcattacagtaacactcatttcgcgtatccacag

acttttatttaagacgtaactaataggggggatattaatgaacatgaggc

gataattaaaaggtcaaacttacgtgtattttgtgttcgtggttgttttt

taatctacgttgatgcttttgtttgtttcgtgtgtcagttcatcgaatgg

gcggttcggcattagcggcctcagaaggtcagtccgtgtaactgcatgtg

aaacgccttcaactgcgatttattgttacttaaacgctagaaaattacaa

aaacgtttattaatgttacgtaaatatccattgcttgttttatacgcttt

gttattcatcgtaaacgctcgtgtttatgataaaaaggtcgttcggtttg

acctgcaggtctcttccaggacgtttggtggcgctgagaagcggcggttt

tcaggatttctctctctcctgtgcgcaaacacACGTGTGAAGATGGAGGA

GGACAGCGTACGCTTTCATGAGATGGGTTTAGATGATCGACTGTTAAAGg

taaaatgttgtattactgctaataatataacctccatctgctttggaata

ttttatggcaggatagcaggttccatttgtacgtttttaaatgttcgttt

ggtctttatgtttaacacgcgaacatcacgctgtcatttctgaaatggag

taacgttaaattgtttataattttgattagttaataagttgtgttgtttt

tgttattatacttttcattatgacgtgttcaagctgtttgttaaaatgtc

gtttatttaacgttaggcaggaagtggaatgtaaagttaactgaagaatg

tgtttacaaaagttcatgttatgtttacacacacgtaaaagtcctgtaag

gttg

hi3073 (3-5)

tatgaaatatttttattatttaaaattacctctttttctttttaaatatt

ttttttctaatttgatttattctttttaattaaagactggattttagcat

cgagtcacctgattcttcataaattattgtaggatttgctgctaagaaca

taatttattattatcaatatttattgagtatttaggttgagtaattgctt

ttctggattctatgattagaaagaaataggaagtttttgtaacattatac

actttatgattcaaaagcttagagtcataattttttcagtgaagaaatta

tagaaatgaatgcttttaagcaataaaagctttaaattcatcaaaagtga

cgattaagaaattcctaatgtcacaaaatggttctctttcagatagaaat

gctgttttgtgttgctgtgtttgacttaatattcatcaaagaaagctgaa

caaatttatagagctaagtttggttttatattcagatattctgcttaata

atataatttcagaaaagttttttttgcaaatactaaattagaaaatcata

ttagcagccaatcactatcaaagtacaaccatgtttacagtcaattagat

agtgttgatgttgttttgaagtcatacttgcatgctatttttgattgaat

attcaaatgagcatggtaaacaacatagagacagttaaatgaacgaatgt

gcaaatataaaaccaagtttacctcaataaataattttactagactgttt

tcttttaaataataataaatattaggtgttaaaaatacaaatacaatgtt

ttaaacagaaaattagcatattagaacgctttttgaaggaccttgtgact

aattatgctaaaaaatcatttttgatatcagcaataaaaaatattaataa

aaaagttatctttaaatatttcaacattttaatgtttatactttgaaaca

aatcagtgcagacttggtgagcagaagcaatttcactaaaataagaacat

ataaaattgtactgatctaaaacttgaccggtcaaaaaaatccaaatatt

aagaaatttgccttcaaatgaagtgctttgctatttacaaaataaaattc

acacatccacaacacaattaatatttacaaaatccaatatataagttcaa

aacacgattcaaaaatagacaaatccaatttatttggtaaaactattcat

gatttacttttttacctgtgaattatcaaagtttaaagtggctcgttttg

ctaataatgcaaataatgcaaataaaaaagcttttgtttttgctaattat

attgacattgactttctgttaaggcacattattatattgataataaatta

taatcattgttatcttcagaatactattacagtcaaatgcatcactgtct

aaatgtgtgagcagtgtaaaaactcgggtgtacttcagtctgtatttctg

agtcattcagtgctgagtttgtttctcagGCTCTGGCGGATTTAGGATGG

TCTCAACCAACCCTTATCCAGGAGAAAGCCATCCCTCTGGCACTGGAGGG

GAAAGATCTGCTGGCCCGAGCTCGAACCGGATCCGGAAAAACAGCCGCCT

ATGCAGTTCCACTGATCCAGAGAGTCCTCACATCCAAACAGgtgatgcct

tggttttattcattcattcatacatacttaattgggccgagaagtagaga

tttttagagatttcacatttgtttatagaccatttcaatgtggtgatgcc

atatggccatgaacatttc