60S ribosomal protein L12

cDNA: Genbank AY648813

 

hi3076 is in the 1st intron

 

agcttgcgctctcttcggccttttcctttttcaCTTTTGTGGTGAAGGTG

CAACAGTTTTCGGTCGTCCCGAATCCGGGTTCATCCGACACCCTCACCAA

TTCCAATTGAAGTGAACTCAACTTCATCTGATACACCATGCCTCCTAAAT

TCGACCCCAACGAGATTAAAGTTGgtatgtgtgaggaatactgtaacgtt

tcgacgggtttttgagcgtgaccaagcggccatgtttgtgctctgggctc

cagagcgccgggactataataaacgatgaatgggtaaaactactgagctt

tatctaaccgaacaattttaaacttaatgtctaatcggattgaatgttat

gtgtctttagaagtgccagctgcggcttattttaacgattcatcgtaagc

tttgaaacgtgattaatgtgctctctagttcagcagtttgctgcacacgt

gatcatcatggagctcgtgtctttagcttaatagtgcagaatagtctgta

gaattgtcaaatacgttatgtagttttaacgtgccttttattttaaacgt

gcaatagtaagttacaaataatagaaattgcagtacaactgctgcatata

aagtttatcattttataaagatcaacattagcgtttattcaaaaatgcat

ataaaatataccattaaaaagttagcg

hi3076 (5-3)

ctattatttaatgtacattattcgcctttaagctgaaagtaaccaggtga

attttattgacttgtcttgatcaaatggacaatcgaagttgcccgttact

taaattatagctttggtgactaagtacaatgtagaaccccagctagtgtt

cttttaacaactttggggggggggggggaatttctgcaaacaatggtata

tttataatgccatactttgtctctctataggccagtttgcccattttctt

ttcggttgtagcataattattatggcttgcatttttttaactgacctttg

taagatgctgtgctgttttcagttgctgtaaatgatacacgatgctaaat

agtttaagttctctcttcgctaatgtcacacagcagtcaacacaatctta

agaacattgtgagtttagttgttaatgaggctagttgtctctctacattt

cttaatttagtttttttctttttagTGTTCATGAGATGCACTGGTGGAGA

GGTCGGTGCCACTTCCTCGCTGGCCCCCAAAATTGGACCTTTGGGTCTTg

taagtattgccataatagtccaatctgatatagatttgctttaagatatt

cagagagctgtgtatttatctgatgtgatattgtaattaatatgacgggc

tttaatccaagtcttttgagccacaaaatgcatgtataggtcatttcagt

gtggtcatgtcattggcccataaacatttcctgcttgttatcatgctttt

tcataattgtaaaaaagcgaatcaattttaacttaatcctctatcatacc

attatcaatatgtggctctttttggatcctcagaagctctgaaaattaaa

aatgtaaaacaggaaatgcgttgggaccgtgtttttgtttacatgcctca

aaatagtctgaggactctgaacata