taube nuss-like (taf 8)

cDNA: Genbank BC049422

 

hi3079 and hi4055 are both in the 1st intron

 

 

ctgttttttcagacaacaacataaatcagctgctgttaacaccgcagaat

tagttattattgttatatatttatttttcaaaatctagattatagaatat

taatatacccctagataaatagttgcaaagcatttttcacaatacacaca

caactatatttacacttctttttatttcctacatctaaagcaatcgctgc

aataaaatgaattatttgaattactgttatgatttccaatctttagaaaa

tagaatgacacaatatttatttatttaaatcaataaatataaatttacta

cagaaatattgtcatttgagattgcttcacaatgatacattttgattggc

aaatctgacctttaacacattaagctaaaccttctgccccatatgcagaa

tgcagatctaccggatatactaagacacaataaaggagaccaattttgct

tcataataaataggcgtaatgcatttctgtgtccacagaatgtgcagcta

cagctcaaattaagctacagatcatttatttttttatgtcatgctgcaaa

aaaaaaaatgacccaaaaaatgtgcatctctttaaatgcaaatgagctat

ttccagaagaaagtgggtcctttacagtctttctcagatattctcaagac

aagacattgttttggttttatcatgtctactgcacttatgtgacatttta

gttcatcatcatgatgaaagtttattatcctcatccgttttaaagccttg

ttggtctgtctcgctttgtccactcatttcaaagcatttgtggtatcagc

ctttgctaagcaaccatcatctgtgctctccatggaaaatttttatttat

ttataattttttaacatgaaaagattaaaagataattgggcctgactcag

catgaatgctgtttttcagcagattcctgctccgcagaacataaaaacac

acagacacccattaacatgtcaaattatatgaaaaatacataaaataata

taataatttggtagcattaaggtctgaggtgtttgtgtctactcccacga

ttcaaatattataataaaactaggattaaaactgatttacctagcttttg

tacctcgttttcaggtcagaacttaaaaattaaatcttctgtgtcagttt

accgttttactaaagaatcatgtagaaagcaaggatgtgaacattttgtt

atctaaaagacttgacatttctgtaagatgttcgacatttaactattaac

attaacagctagttcgtgtgtgatggttcttttattcaaatcattaaaat

aaaaataaagataacatatttagaagtctttagaataacttaataaaagt

tttatgagcatgctacaataccgtattgacgatgacttcaaaaaatgcaa

atttctacttttgctttcatttttaggaaatggctatgcaacagttattt

ctttgtttgacttttattttggaattgcacagaaaacaacaaccttccgg

tcgccctgttggaaatgttgatagggttgccattttcgcccaatataaaa

acaccaaatacagtttttagcAAACGCAGAACGCACAATGAGTTTATTTG

CGAATGCTAAACATCAGAGGAAAAACCACTAGAGTTCTAAAATGGCAGAC

TCGGTAATGATGGGGAGCGGATCTTTAAACTCCGGAAGCgtacgttaaat

atctcctttcattaacgctaacgttactctttccttcaccctgctggctc

agcc

hi4055 (5-3)

aaacaatactaactttagttttttgatcaaaattagac

hi3079 (5-3)

ttaaaggcacttgtgtaatatattttaaagcagacaccgtatcgtatgta

aacacgtctgtatatatatatatatatatatatatatatatatatatata

tatatatatatatatatatatatatatatatatatcaattatatagtgag

ctgcggcagatcagtgtcgtcaaacagtgttttatata

 

approx 2 kb to next exon