talin 1

cDNA: Genbank AY781336

 

hi3093 is in the 1st intron, before the ATG

 

agatctgcgtctgttgttgtgagcgtgcatgcgtgcgcgctctcgtaggg

tggagtttaacacaccgcctcaaagcaacggtgcagaaatcacttctgac

attacATACCAGCATTTACTCAACAGGAACTTTCTGCTGGGGGACAGGGA

TTGTTAAAATACTGGATATTGTCCTAAGGTGGACAGCTAGTGATCGAAGA

AACCTGAGAGgtaagacctgaaactaaatcgcgtttacaactttacacac

ttgagctaaagctactaaactttttcaagggtgggaagtttccttccgat

gcgaagatcctgctatgatcttcattaaagttatgcc

hi3093 (5-3)

gaacaatacgacaatgaatccctttgtgttgaattgagatgtaaagaaac

gttttattttgacggttattccaaaagacgttatgaataaggtttagagg

cgacagcagcacattaaaagttgacttttcccccctccgagagtctcaga

caaacttgctgaaaatttaacggaagaactagaacttgttttataaactt

ttacctttaaaagcggccatttttgagaacagttcagtaatttgcttact

ttaaagtgatttgttgtgatggcctacggctttaaactctgaagtgtagc

aggcacacgtcacggaaggaatgaagcccctttgatactgtaactgtaag

aagttgagagaaaaacgcggcctacactgcaaacgctcataaccgagcgt

tattgtttactcagcagtcgagatggagtgttatcacttcatgtttttac

cctgtgtatcacgccatacacacctagaggctccaaatatgtcgaaacaa

atgtcaaattaacgttattcctcatgctggaa

 

approx 48 kb to next (first coding) exon