nucleolar protein 5A (NOP56)

cDNA: Genbank AY648814

 

hi3101 is in the 1st intron

 

tcgagtgatccGAAGAAACGCAACGCTCCTCGTGCGCGGAGCACGAGATC

AGCAAACATGgtaaagattcaatttttcatcatgcaaactttagaaatca

acaaatagcttacctatgcattttaaaagccactatgtcatatattaagt

cgtgctgtt

hi3101 (5-3)

atgaatagcgtgcatgttcgtgagacgtacttttgtacatttacacgtgt

aaatgcgtgcttttttgttattacacattaattacagtcgttataattag

tttattaagcattattacgatgcgatctattaatacaaactgcttgtact

aaactgcttataggataaaaggtgaatccgcaaacacaaggcctcagggt

gatgttaaaggccgcagcagccattaaagtcagtctgtttggctcgtaaa

gtataacccacctcttgttagtgttttgaggcgaagttctggttccgatc

gcagtgctgtgagatgttgagttttaaaagtgctacgcgctgagtatccg

atccgctgaaggaacacgtggtgcgtctgctaacccatgctaacgtgcgg

atctccccagcttcgagccagcgccaatgttataaagtcgaaacatgggt

ggcttattatcaactgttatcttttgcttacgcaatgttgtaaagtcata

ataaatgttttaaatcttgactgttgtgttttgaagtgctatcatcaaca

tgtgggctccatgctccgactgatcagtttcccaatattttacttgtatt

agcgttcattgttatttgtgagatcattaagcatttgggagtttgtctta

atctactgtaagtgatgatttatggtttgagctctaatcagtgtggtttt

ctccctctcagGTGCTTTTACACGTGTTGTTCGAGCATGCGGCTGGATAT

GCGTTGTTGGCTGTTAAAGAAGTGGAGGAGATTGGCATGCTTCTACCTCA

Ggtttgtattttctggaaagaccaatggatttcagtttttg