nucleolar protein 5 (NOP58)

cDNA: Genbank AY648816

 

hi3118 is in the 1st intron

 

cacatttcactgccagtattgcgcatgctcgtcctgtcccatgtGCGCCT

CGTGGAGAGAGCGACTCCTTGTAGCGGAAGGCTCTCGGTCTCGGGAGCTC

GACCTTAAACTTTATTCAGAGCAAGAAAAGCTGTTTCAAAAATGTTAGTG

TTATTTGAAACTGCCGCCGGCTATGCCATTTTTAAGgtaagctcattttt

ttgtgttaattaaatgtatttgtagccgttttcttgcagttgtgtagctt

ttacggttacacatagctagccggcgaagttagcagtgctgtccgagact

ttcaaaaagacaaaacgtacaatctaaggatttttattaatgcaaatgct

gtta

hi3118 (3-5)

gtacatatgtaattttgtagctcactcgtttttccccagtgcggtgtgtc

aatgagggttcagcgggtctcatgtggcctgctctgcagcacagccacgt

tgtgtcttcagcgctttttctacactcactgttagtcgagtttggactgt

ttttaaaatagtcaagatgataaaatataatttagtagttgcaaaacaga

tacaacaaatgtatttacatatttaattaaatcttatgaagatatttact

gtttaaatgcacctcgccactatagctcatgtttccacatggtcgctcag

cgtataacgttagaggtaacgttaaagttggttttatattttcactttcg

cacattctccttaaattaagttcagaaaagaatcatttacaaattctgat

tggtaaaattgtattcgtagtcaatggcttatcaaagtataacattgttc

acagtcgattaattggtgcttatgttgctttaaggtatacttcaatgcga

tttcagacccaacactcaaagtaccatgataaacaatatagggactatta

aatgaatgactgcgaatataaaaccaactttacctcaatgcttagtgtcg

accgcttaaaggctttaagtaagtctagtatttagatggtgtctgtgcac

tttaatcaacagctttttctgttgtccagGTCCTGGATGAACAGAAACTC

CAGCAGGTGGACAGCCTGTGGAAGGAGTTTGAGACGCCGGAAAAAGCCAA

CAAAGTgtgagttttacagtagaaatgtgtaatattatatcaaatggtgc

cttgtctcagaaatgtccttgatttgatgatgtttaagtcgaatttctga

taatatagtttataaataaggaaccaaacatgctttaaggcctttgacac

atataatattaattttttttattttttattatatattactttatcgatat

agtcatgttttattttcaggtaattttggacaatgtatggcgtttcattt

ggtgtcaacaatgctttaatctctatgaagattgtataagtgtcaacttc

tgtgaattatttttacatgctccccattgacaagttgtacatgtacacta

ggggtgcaacaaatcaatataatcacggtttctgtatggtatggtttgtg

ctatgcttagaaaaaaatgactacagaacaattcaaagaacaataaacac

atttattgatgaacaaacacctgacaatgcaacagctttacacacatgac

cttagatttgcatgttcttgcattaaataaaagtagggcattttgaaaat

tgtatgttcaaataaactgctaagaaaatagagagctttaatttttctat

tttacatctccactcaacagtctcaaccaattatgctaataattgtcaac

acatattcgtaattgggcacttttaaagtattgattacttctgtttacat

gatgcttgcatttctaagacaacaacacatttttatttatgatttcttaa

tgaatttattatgattccagagggctcctttacacttactagcaccatcg

tagtgaatgaaactaaagcagagagagtgttgggctcttctctcctaatt

cagggggaacagtcagtcgagaagaaaacttagcagacagcgggtaaaaa

gagtgaatagcggggttgattggtgcggaagaacactcagaaagagcggg

actgaagtaactgtctgagcccttatgggacgcttctgggtcctgacacg

gaccttgatccacctgttggtgacaactgatctaggctatcgttgcaaca

acagcaaaaaaatggcatttatgtttttgtgtctgttgacactgacagca

atgctctgcgatttggccttacctgcatctttgtgctgtatcttcacttg

ccatgctgaaacccacagaaactccacacacaccgaaacgagatgtgaat

gttaggtcttcgacgagaatatcaacgttagagtaagcgtgaaagataat

caaaagcatacaaagagggggaaactgccttgttgcagttgtttctacta

acaaactaatattaaaaaatgcatattctgagccatgg