WD repeat domain 12 (ytm1 homolog)

cDNA: Genbank BC044198

 

hi3120 is in the 2nd exon

 

agacataagcagttgccagcgcatttgtcgatcgtcgattgccatctgca

atcgactgtcatgccttctccAGGCACGCATTGGGAAACACATGGTGGCA

AAGTATCCCCATACACACTGAACTTCGCCGATTCATTTATCGCGTGTTTT

CTAAGCGGTTTTCTTATAATAAGACAAAATGTCGCAGCTACAGGCTCGGT

TCTTCACTGAAAACAAAAAgtgagtataaatgtccacgatagcacagcta

acagttagcttagatgtttagctgtagcttcgtaagtaatacccagctga

catttgctctgcagtaatcagtgttcataagactgctttataaactctgc

tcgtcgtttatgtgtgttaacagatttttaagatatataagattagtaga

tgtgtaaagtgtatgagctgtgtttttatgctcttctctagATATCTGG

hi3120 (3-5)

TAGATGATGTTCCGTTCTCCATCCCTGCCTCCTCCGAGGTTGCAGATCTC

AGCGGTGTCATCAACAAACTGCTGGAAGCCAAGAACGgtcagattctgga

gcagttattcattttcatcgagtgttgtcaatttgttatgatgcagcgtg

attgtcctgtgttatccactgttttctaaaaaaataagtggaatcaaata

atagtgatttaaaggcacagaatgttatagtttccaaaaacaattaaaat

gttttataaattgccatatagtattatatattttgctgagttatgcacaa

ccaaatgtttcgaagaa