interleukin 10 receptor, beta-like

cDNA: Genbank NM_001034185

 

hi3147 is in the 1st intron

 

tgaaataaacaaaaagcatctctatcacgtgactgtactgtacagcgctc

gcgtgttgttatgaattatgaatgacgtcagtgtttgtggtgttttggac

acgccccctgcagcgtcacagtAGACGTCACGTGTTTTCTCCTCAGTGAG

CGAAACCGAGAGAACGGAGAGAGACGCGGATCATGGAGGAGTGTGCCCTG

CTGCTGCTGCTGCTGCTCGGGGCCGCCGgtgagtgtgtgtgtgtgtgtgt

gtgtgtgtgttagtgtgcgtgtgtctgagtgtgtatctgtgttgagtctc

ccgctgtccgccgttctggagcagcgcttccggtcagggcagctggagtt

ccgctcactcagactgaaactgatcatcccgattatcttcatgtcgatgt

aagtcatcgatatctctgatgatgatgatgatgatgattactgattctgc

cttcagacggcaggaggggaataccgcggggcttcagctgtcacgcgctg

gaacaaagagatcaaagcagatttacacaactttcacttccgccgcgact

gaacactaacacaaactacacacatcaacacacacacacatcagcacact

acactagggttgggcatctaagctataatgccgatccgatacgcatctcg

atacaaagaatacgatccgatatattagcgatacatttgtgacatattgc

gatgcaacacgatacgattcacacccatatcacgatacgatgcgatattt

cagcactaactaattagatcaagtttatgagatgatgtgaaagaggatgc

tgtgccattgaatgagtttgattatttataaaccagcaaaaccaagactt

ttttttacaaactggctcttctctcagagccagagtgtcagtttacagta

gagggccattttagaacatatagcacataatatttaagtattttcaagat

aaacagaatgtataagtgcaatatatattaaaatatatatatattcgcaa

ctctttcaacataaataaatttagcattgcacaacaagaattgtgattta

acttttcaactatgaaaacaagttttacaaagatattttgccactgatta

ttcaaaacttaaggtggtgaactagcagtgttatgctgctttgaaacatc

actgtcactgtaaacaacaggctaataaaaatataacaaaccagcaatct

tcttgctgtgaggtggtcaaactacccactgtgccaccgtgacacccaat

tatttttatcattattattattaatattattattattattaaataaaaat

taacaggaggaggtgtttaaccttcgttctccgtgacactaggctgaata

tctttgcagatgaacaatgcaatagcatccgttattggcgtagagcgagc

agaactgttgcgcatggaaaaaaaacttgcaatgcttttcttaccacttt

tggagctggttgaagcagtgcgaaagccggggatgcagaaacactggaag

atgctttcacaacaacaccgaggcgccgcttcaagtgagatttcagatta

ctcgtactgcccacgtattttacagatgcgcggcacattttgcaaattgc

atctgtcctgtcatgtcgtccatccttaaatccataatgttgcttgccat

actttagatttaaaactcagtggggaataaaatgtttgttttgcttctcg

cgctttctgagggcgctccactagcttcatccgcacacctgatacactga

gttgtagtgtgtgcacatccgcaaatccgttgctaaggcttactttatgt

aggtcgattaaattatgcgccaaaacaggttgacaacacttgttaataaa

taaaaaatacattctatattaaaaatataagctgtatctcggaaaaatcg

atgcatctcgcaaaaaccgatgcatctcgatttgcttccaaaatttcatt

catcctctgctgctcaaccgatgcactcgcatcgtgcacgcgaatgaccg

cgtatcgatacatatcggttaatcttcccatccctacactacacacat

hi3147 (3-5)

caacacacacacacacatcaacacactacacacactacacactacagttc

ttctaatgttctgatttgatgaccgagtcgatcattatgatcattatgag

tcgatcattattctgatattaatgtttcgtgtgtcgcgtgtggatgcatg

agcagaggctgtggagctttattactgacgacagaaccctgaacagccct

gctgacctgctgcactcacaccggaccagaaccgctcctcatcagctctt

tatcttaatcaatatttatacgatcatgcttctggttcaggatgagtcag

caagactatatactgcattgcttaactattaataagagaacagcgggcgg

cacgggggctcagtggcatcacagccagaaggtctctggttcgagtctcg

gctgggtcagttggtgtttctgtgtggagtttgcatgttctccctgtgtt

ggtgtgggtttcctccgggttctccgggttcctccacagtccaaacacat

gcgctataggggaactgatcaactacactggccgcagtgtgtgagtgtga

gtgtgtgagtgtgtgttatggttatggtatgaggtctgttgtgagcccag

tgtcgggttcttctgcttgtttttctcctcattttgactcattattgctg

aacacaacactatatgtctataaaaagcttctggatgtaggagtttgcct

cttcaggaatgaacatgcagaatcctcagctcaaacacacacacacacac

acacacactcctgagcgcgcgcatgcctctgctggcagattagaaagcac

cgcattacatcactgagtgacccgacactgaccatcacactcacactgaa

caccctatgatgaacacatgcacacacacacacacacgcacacactgtga

acacagtcgttatcagctgtgtttatgatcagtcattcagccaatcacca

cctgagccagtgtgagatcagccgtgtatgatgcagtccatccatctctg

atggagacacactgctctgcacgccgctctggtcattgtcctcagctcct

gaatgtggaccgtcgctcctctgtgtgctgtaggccggtcagtgtggcca

aatgcacttttatttctgaaatatcagcaacatttcgacattattcacag

tgtaaaggcgatcattaaagactcatcatcatgacttgcagctttagaca

ttaaaaaatgtgctgcacctcaatctgtgtgtgtgtgtgtgtgtgtgtgt

gtgtgtgtgtgtgtgttccagCATCCACAGGTCTGAGTCCTCCACAGAAC

CTCGGGCTTCAGACGCTCAACACCCAGTATGTGCTGCACTGGGACTGGCC

TGGAAACCAGAGCGCTGTAAACCAGAGCGTCCGCTTCACCGCTCAGTACA

TGTCgtaagagccacacacacacacacacacacacacacacacacaca