pleiotropic regulator 1

cDNA: Genbank AY648817

 

hi3174a is in the 2nd exon

hi1902 is in the 2nd intron

 

ataaaaataaaatacgaaaaaaaaaagacttttaatggactgtcgtgtct

tgctgacgtaacaccctaccggaaaacgctttgtcgcgcccggaagctgt

GCGTACGTTTGCACTACTGGTTCGGGTTGTGATTGTTCGGTGTGTTGGGA

AGTTTCTTTATTTGCGTTAGTTCGTCGTGTTTTAAAGGACCCCCAAACAT

GACCGAGgtaaggctgtgctgttgttgcattagccgttgttcatttgaaa

atgatatctgtttagtttttctgtaattgaacgcggcgtaacgttactgt

attaccacacgtgtggtcatttggatctgcatatacgtcttataatatcc

aatcaattaatcgatgttgatattttgtcttttttatacacacagGACGT

GCAGAAGCACTCAGTCCACACGCTTGTGTTTCGCTCTTTGAAACGGACTC

ATGATATGTTTGTGGCGGATCATGCCAAACCTATAGCG

hi3174a (3-5)

CAGGACGAGCAGAGgtaaataatcaaactttttgctctcagtattgtatg

gcaacgttgattaaaaattaaaatcgatatagacctttcactcaccctca

gatggttccaaaccttaatacgtttctatttaattgagatatgttgaaga

atcttggaaaccggttgccattgacattcatagtagggaaaatattataa

gcgtcacattgaggtgaagctggttttgtattcgctcattcggactttct

ccttaataatataatttttgttaaagtaatctttgcaaattttaaatggg

aaaaccatattagcagccacgactatcaaaatacagtattgttcacagtc

aaataaatggtgctaatgttgttttgaagtcatatttatatgtgatttca

gactgaatgatcaaagtacctaggtaaacaatatagggagcatgtcacaa

gttatcactgaaagaatgtacggatataaaaccaacttttcctcaatgga

catcattggctaccggcttccaagattcttcaaaatgtct

hi1902 (3-5)

tattttgtgttcagctaaaaaaaatctgacaagtttggatcaattgggag

gtgaatcatttttaatttttgagcaaactggcttttcaagcagaaaagac

attttgaatggtggtggttggtggtgaatggtgatttataaactcgtgtt

acagggtttgttaaagccatgtttttttacaataacattttacagcattt

gacaggctgttcatcaccactgtgaagatcctactcaatgcttgttttac

aagatttccttatctgcaaaacaaatttcattggactgtcctgcttttaa

aggggtggtccagagtgtatttttaagccttgttgtgtttataagatgca

aagcaatgtgtgctcatgtttaatttgtagaacatcttactttgattata

tacaactactcagctaacatgaaaacaactgtcatttcctagtttcttca

aaagcctgtcctcaagaggctctgattggtcagctaacataatgtgctgt

gattcacagatcggctccacgtcaccaggaaatgcacctctaatagcatg

cactgtgcctttgcttgtgtaaatactgtcaatcagtttagctgttagtc

atatcagtttgagcctgaatcagaaagaaaaagaaaaggacacagctgaa

cctcacgcccgttctctaaaataaaacctgacaagtgtctttcacatata

tccggaataagcatgtgtaagtaatatgaaactttcacatatcttttgcg

agtttgttgtctgagatgtagaacacagggaaatcgacctcatagacact

gcagcgtggtaaagattgtggctgtttacaagggtttgatggacaaatat

gaatttgtagccaaattgttagtagtgccctacagcatttcccattgttt

acatttttgtttgtgtctttgcttcagcataccgttaatgatagaaactg

tgcatgtagtagatcaattataacaaatataaatatcagttttgtctatt

atggttgcaacttctgcttctttggaggagttttagccgaatccaacact

gaacttggaaacattctggaagctgtcctttgtcaaatgctagagcttta

tcatttttatcattctctggaacataattaaaattaagctagttcgattg

agtaggcgcagccaatgtgacatcgtagcggagtttgcggaggtttgggt

gcgtacaacatgatttcgggaatagttttttttctttacactcgagcaaa

cagtgtgtgcggtgccgcatttgatttgagtttaatatgaaacactttga

agagattttgtctggaacaggtacgcctgtacagacatcttttgtagaga

taaccatttataggattttacagtgatgtatatattacaattttgaattt

aaaacaatttaatagttacaaaactaaaatgaaggaacaaaatatttctt

tgataactggaaaggaatatttaaacccatcggtttacaatatactgatg

gcttgtttgtctaggctttatcaaatcaaatcaggcctttatttgtcaca

tacactttcgtattgtgaaatttgaccatacacaaacatcacaattttca

ggggaagacaggtcacaggaggtagcatttagaaaggcaagatgcatcag

gagggttaggcaaaaaataccctctaaactttgctcttgattagagcaaa

ttgagacggagaaaaacagcccatctagcacaagaaagcacacagacaag

acacaacattgacaactgggatgggaacaggggatatggatgtagtgcga

tgagggtgggcagccatctggtcctgcagccatggaggagctggtcgcag

acccgcccactcctctcatgggtgaaagcatacgaaggcattaaatattt

cgtaaaaatattgaatgatattaatgatatgacttagttccggagacgtt

ttacttctctgtttatccatcttattttatgatcagtttcttttgactgc

cccctgtcattttaaggaatatcacaacagcgaacacggcaaatataaaa

gcctcgtctgtttcgcgaggtgcgcgtgcagtcagcggaggtctgcgttg

ccaggcaaaagtataaattctgcttaacccggatgtaatttttgcagtct

ccaatttttgttcgctataggctttgctaggcttactctgtaaaagtcaa

tgtttccctttgcattgaactttgagcgcattacatcagctacattacac

attaactaaagtttaaaatatgatattgtagtggatcacccttttaatgt

ttgtataaacctttcttatgctgtaaactcgcttagaattattcagcaat

gttttgccacaaaataaaaaaaaaacttgataaatacttggttctgcttt

agttgaatgtactatttacactattagcaaaccatcagctaagacattta

gctctctaactactaattagctgctttgtaatagtaaggtagtagttggg

tttaggtatttgagtaggattagggatgtacaataagatcaaactttatg

agtgctaaaacattgtaatatctcaataatagaaagctaataaaccagta

gtaaatggtgtaaattgttacattaattgttacttttgttaatgttattt

acgttttgtctgtagCTTCAAGGTGAAGATGGCAGCAAAGATGCGGGCCG

AATACAAAGCTGTCTTACACATGCCTGTGCTGAAGGAGGGCCGAGAAAAG

GGTTCTCTCCACACCTCTGACCCATATGGCCAATCGGCGTACCCTCTGCC

TGgtatggctcataaaccaatcctgttggctttttctttatatcagtatt

ttcatttagtttgtttttttaataaacctctcaaagatttcattaactat

taactgtttgacttcatttgtgcagACACTACTCCAGAATATTTGGTGAC

AGGAACACACCCTTATCCATCTGCTCCAGgttgaaccaggatttttttac

ttatttagcctagatgctaaacatttcaaccaatttatttgaggcctaat

aattttttttttttttttattattacgctttcagGAGTTGTCCTCACTGC

AGACACACAAATGCTGAAGATGCCCAGTGAAATGGGTGTTCACTCCATGG

CCCTTGCTCTTCCTCCGTCTCAAGCTAGgtactgaattgtatttccttat

gggttgttgtagttactattaaatgtttttagaaaaaaaaaaattatata

tatattttttgccataaaaaacattttaaaaaat