ribonucleotide reductase M1

cDNA: Genbank NM_131455

 

hi318 and hi2729a are both in the first intron

 

 

aagaagaaggagcgagaggccattagccgagatttgtttggcggaaatga

cgaagtccattctggcggcttttagcgcgctaagaatttcataacaacag

cctgacggagcagctgagaagccggcCAGCAGTGCAGCCCTTTGTCCGCT

AAATACACCTGATCATTTTTGTTAAAAAGTGTACAGTTTTTCTTCTCGCT

GGCCTTTCTGACGTTACCAGATACCCCAATCATGCACGTGATCAAGAGAG

gtaacatttttactgtttcttcaaataacgttactgaactagagaaatat

atacaaatgtaatgtaattgcgatttataaaatgttcttatcgtaaccat

tattaacctgtattcagtctttaaatcgtgagcattagttgagct

hi318 (3-5)

aatgttataatttacaaaatgttttgccgttaagagatgaacgtcagtca

gtttagtctgtttaaaatattgatgaacaccacacatatttattgattga

ctgttattgggttcatttttgtaactgcataatttaatatttgagaataa

cataattgcgtccatcttggcagcagccgatgttcacgtaacgttagctg

ttccctttgttaactcaaagttggcgcgaatcgcttcgttaaagtaggtc

aaattttatttgacagtatttggcttgaatatcgaatattaagtatattg

tgatttaatagactatgctagctaaaatgtgcaatgctatactcgcgaac

agcacattttatggacctttcatattatttgcgtttcatatcctgttca

hi2729a (3-5)

tgtatcattggttatagatttgtactgttattacatttatatggttatct

ttaaataatttgttttatgactatattttttttcacagATGGGCGCCAGG

AGCGTGTAATGTTTGACAAAATCACATCACGCATCCAGAAACTTTGCTAT

GGACTCAACTCTGACTTTGTTGATCCAgtaagttgtgaaatgtccatcaa

gacatcttaaatttcaacctacgtctagtgcaattatttatttacttttt

ttatttaatgatttaagaaaatccagtttttctaaaaactgaccctagtt

tgaaagctcatgtgagtactctcgcttcttttcctctgttgggccagtat

tgacaacagaccgggtcaaatcaacagcttcagacctcaatgagtggaga

actcctcccctaaccccacccctcacagtgacgtcactagctccattgag

tgcattgtgtcttgacatttattgcatttccgagacatgcaatgtcagtt

tgcatatgaaagtctgcaagcaaatgctattaaaattgttaaggcaaaaa

tagattagcagcattaaaacctgcttttaacacaccaccacagaaccgct

caacacaactttactagacaaagggaaattgaatgaaaattggttaatca

c