MCM3 minichromosome maintenance deficient 3

cDNA: Genbank NM_212567

 

hi319 is in the 1st exon

hi3068 is in the first intron

 

gattccactgcgagagaagtctggtggcgcgaaaaggcacacaacagtgc

tgcgacagacacgaggtgttctgcactgaactTTTCTCCATACTTTTAAA

AGATCTGTAGCAAAAATGGCTGCTGAAGTTGTGGACGATCAGGAAATGAG

GGAGGCTCAGAGGGA

hi319 (5-3)

TTACTTGGATTTTCTTGACGACGATgtaagcataaatacgttattacatg

tttattagaggttgaattgttgtagttaaggtgccttataggaacaaagg

cccacacccacgtaacttttttcgtagaacttttaaagcatattttgcct

gtttacaactttattc

hi3068 (5-3)

ttgcgtttttactcttttccagCAAGACCAGGGCATCTACCAGAGCAAAG

TACGGCAGATGATCAGCGAAAACAAATCCAGGCTCATTGTAAACCTCAAC

GACCTGCGACGACGAAATGAAAAGCGAGCAGCAAAgtatgtctagtttgt

tccccttcactactacaccatgtgcacatgtatgatcaggtcatgctatt

ataatttgcaagtatatttccacgcgtaatgacatcataactacaggcat

tttatattgtaccgaaatgga