poly A binding protein, cytoplasmic 1 a

cDNA: Genbank NM_001031676

 

hi3202b is in the 1st exon

 

agatctcggagacgagcagctgaaaggagtttcctccgcagggtggcagg

gcgtactcttatagacaaggtgaggagctctgacacccgggaggagctca

gagtagagccgctgctcctccacatccagagaagtcagctgaggtggctc

aggcatctgtttcggatgcctcctggacgcctatctgagatgttccaggc

atgtcccacctcggggaagacccaggacatgctggaggaactatgtcttt

cagctggcctaagaacgccttgggatccccccggaggagctggaggaagt

gtctggggagaaggaagactagagttctctgatgaaaatgaatgaatgag

agcacagcagtgtctatacattcagtcattttaaagattatctggggaat

aaaaacattgattgtaatattttatacatatctcagatgtttagctttcc

aacagtttcacagaatacattaagagatcaaaataaatacaaataaactg

tcaacacaggagacgacctagcaaatgtgtgtgaaattgtgcttttattc

tatttctcttctatgctcttattgtgcgcttacgtaacacataagataca

ccccgcaacatccggctttcgtgcgcttttatcagcgacgcacttccgct

tccttcccctaccttGTGCGGTGCGAGAGAGAGCGCGTGTTCCTCAGAGC

CTCGGCACACATTTTATAAAAAAAAACCAAGAAAAAAACAAAAAAAATCA

CAAAACCGAAAAAAACACCAACAAAAAACTACTTTTACTACCGCAGACCT

CGGCGAAGCAGAGCGACGAGTGTTGTAGAGCAGTTTAATAGACGAAGAAG

CAGCAGCAGGCCTGAGGAGACCCAACACCGCGACCGCCGCCATCTTTAAA

ACGGAAAAACCGGAGAGCCTGAGAAAAGCGGACAATCGGAAATCCAGCAG

TGTTTAAAACCCTCCAGCCGTGAAAATGAACCCCAGCGCGCCCAGTTACC

CGATGGCCTCCCTGTATGTGGGCGATCTACACCCGGACGTGACGGAAGCG

ATGCTCTATGAGAAGTTCAGTCCGGCGGGACCCATTCTGTCTATCCGGGT

GTGCAGAGACATGATGACCCGCCGCTCGCTAGGTTATGC

hi3202b (5-3)

CTATGTCAACTTCCAGCAGCCCGCAGACGgtaagagaagagagatgcacg

ttatctagttaaacactaaacacacagctaacgttaaccagtggacgctc

gcgggcgccattactgctcggtcgcgtgcgcgcgtggatacagctgctga

cagaagttaattatttgtattactactgtacatactgtacattaatgtga

agcttggcttaggggtatacgttaataaaatactatttaattagggtggt

taatgatatgaatctcgccgacttccggttgtagctgtatcctttc