protein kinase C, iota (atypical protein kinase C lambda)

cDNA: Genbank AF390109

 

hi3208 is in the 11th exon

 

tgcatgcctgcaggtcgactctagaggatcctaatacttatcgaactgca

ttgtacataaataagatgaacatttttacattagtcaataatattacttt

atttaattaaaaaactaaataaatatagatttacacacatttactcgggt

aaatgaacagaattaatgatgggctaaaaatctgcggaaaatctgcagag

ttctgcgtgcgcagattccatgtgagcctagtcataagacatcattaaaa

tacatgtataaaaagtgtaagatgtagtgagaataaaaagtaaatttttt

ttttttttttaagttgtacacccaaaattcaatataagtgacctttaggc

catttattgttgagccttttagttaagtgtgaactgtctttgtctgataa

taggggctaatgattatttaatgctgttcattcacagACTGTTCTTTGTA

ATCG

hi3208 (3-5)

AGTATGTGAATGGAGGGGATCTCATGTTCCACATGCAGCGGCAGAGGAAA

CTTCCGGAAGAGCACGCCAGgtctgaggacatccaatgcataacactttt

aacgttgtctgaacgcctcgccacaggaacagaaacaaaaatgaggtcac

ttactgtgtgtcttgttctttccgctcgcagGTTTTACTCTGCAGAGATC

AGTCTTGCCTTGAACTACCTCCATGAGCGTGGCATTATTTACAGGGACCT

GAAACTGGACAATGTTCTGCTGGATTCAGAGGGACACATCAAACTCACCG

ATTACGGCATGTGTAAGgtaagtctgaatgtggtcattggttaaattttc

cacttgctccaaaccgaaagtaattgtgaaaaatgttgggtaccaaaatt

ttgatggtaacctttgaatgagtacaccacctttagaaaatgaattttta

tacatgtccttgtggatattgaaaatgtatgtattttggtccatttaaac

aaaacagttaaatatttaatacagttattaaatatttattaaaataagag

tgtgatcacctgacattttttggaataaaaatgcatttacatttaaagtt

gtcaaaaaaatggcaaactgaaaaatttcaatacaattttctatattttt

gtggttctcttgatttttctgtattaaagatttattttacattttcctta

agatattcattagttggtacttatttttgcccatcaatcttaaggtattt

tcttaagtaagttttggctttagtactgactactgtaatgtatggacaca

aatatcttattgtatagcatccttttcaatagcagaccccctagttttca

cttttttagaaaatatatatattttgtggtggtaattcccagaaatttta

ggaaaaatttgtcaataaaaaaatagttatttttataaatgtatatacat

ttaccatattaggttgcctactttgttaggtgtgcaatctgacaatgaca

caaatcataaaaataaagcttctttattttggtctcttgtcaagacaaga

tct