cell division cycle 2

cDNA: Genbank AF268044

 

hi3235 is in the 1st intron, before the ATG

 

acatcaaatctttctgaaatcaaaccatgtaaactagaatactactacta

ataataataataataataatagtccaattataaaagctaataagtagctt

ttctacacaatattttacacgtgtctccctctctgtctttttatataata

tacatataacaaataaaaacgtaaatataaattagcatctgttggagatc

tggttaaataatactgaaaagaacagtccaacagtgacaccaagtcgtca

aaaagagtaatgcatgcgtgctcgtctgtgtaccactcaaaatcaatatg

tgaccattgtatgagactcacaatataataattacattatttgtttgttg

tttgtcgttacaaatgtaggacatttaagacacaagactgcagcaacgaa

cgcaatgaactagaatgtcggttttagggtaactaaaggacgttagagat

gtttccgtctgaacacccactaccagtgatatacagcaacaagtgtctgt

caaaaacgtaaaaatcgctattcctacctgcacaaggactactttgaact

aaatatacaacaagccgcgcatgcgcacattatccaacacagacgccgct

ttcctcccgctcccaaccgctctatcatctgattggttgattttgaagtc

ccactgagtgcgctgattggctgcttttgaattacgtccacgcggccagt

ttgaatcaaggaactCGCAATTCAGCAGGACACACACACACAACATCCGC

AAGCTTTTTCATTCCTCTAAAATTTCGAGAACTCTGTTGGACGTAGGACA

GTTTGATATTCATCCATATTAGATATAGTTACAGAAAAGgtgagttttta

aaaatccatgatgatgattgactgttatgttaacgattttgattctgatc

gcgtaacattaagttgtttgggcccaactgagcaaaaactacttagtcat

ttaactgtaagttgatactgtaaactttactgaatgatgtttttgtttat

gtaattttaacgttgcaaatgtacgtcctaaataaaacagacggttgatc

atttgattttagcactagtttctgctgcatcttgattttccgttgccaca

ttgctaagttacttatttttctcatgaaaacgtgtctgacgttacgaggt

ttttaggcacaaaattatgactttggaattatgaaaaa

approx hi3235 (5-3)

ggattttatctaatggttgtgattttgatgtcaacgccaaaagctaagac

ctgttcagtcagtcttttaacggtacacataatgtgtatatttgacatcc

actgtaactttgattgctttagatagttagtttaaagcaaaaacgaacaa

gtttaatgaagaaaataaagagaaaagtttcattatgcatccagactttt

tttcctctttctaaaaataattaaaaaaaatgattctgaaaatgtcatgt

tatgctgtcattaatttactttttttattctttgtgttttttcaaaaaag

AGTGTTTGGGGAAAATGGATGACTATCTGAAGATAGAGAAAATTGGTGAA

Ggtaagatttatcttgtgcttattgtcatttacattagctactattattc

ttagctagtctctaaataataaaactgagagtgtttttagtgaatgtcta

atgtaaatatgtgtgtgttctttagGTACGTATGGTGTAGTATATAAGGG

CAGGAATAAAACCACAGGACAGGTGGTGGCGATGAAGAAGATCCGTCTGG

AGAGTGAGGAGGAAGGCGTTCCCAGCACTGCTGTCAGAGAAATCTCCCTC

CTCAAGGAGCTCCAGCACCCAAAACGTTGTACGgtatgacagatttcatt

acatgtttaacaaaacaaataatttagagtcaatcagatttactgtacag

aaagtgctgtttgtatgcctgtctctgtggtggtgggttaaagac