THO complex 2

cDNA: Genbank AY648818

 

hi3237 is in the 1st intron

 

ctatacactgaaagagaaataatttgatatattaaacgatataataatga

aattaaggaactaaaacagttcaaatactccattattaaatactgctttg

acgcgctcaactgtgtgtgataaacatccggcgcgcgctacggctgcttc

aTCTGAGAGTGTGGAGGAAGATGGCGGCGCTGATCCTCCCGTTTGACTGG

TTAAAAAACTGGGACAAATCCGGCAGAAATGAGTTgtgagtatgagttta

ttaatcaaataggaagtgtggattgtaataaatacatttaccttttattc

aggtggaatgaacacgggttattgttgaagtcataaatcatattctcttc

attgtgaatggccacggataatgtgcgttaaatatttttgttatttaaag

ttctataaaataagccaaaaacaaacaaacaacgaaataaaaacaacaac

acaacttaatgtagtgtaagctgataaatataacgtatgtgtttctgtac

agggatggtttggac

hi3237 (3-5)

atatcgggtacttaagtaattttccgtgaatgtatcaccagtgagctaat

acttagctgggttagcattagcatgtgtgcgttgcatgtgtcgcgcaact

aaacaagctcattttcatgctgagcagacttaaaagtgggtaatacgcga

tgcagcgaggttttgtaaacctcgtggaagggctagatgtagatgtgatt

aagacttcagcctcactttttaaaatccgttacgaagtaatggttgtctc

tcgaaacctagttatctgccaagacctatttacgaggagcataacccgca

aatctactaaattcctgcacgaccgtgtgtgcttaataaattgacggaat

ttttgagggtgattgatcttgcagtaaagtgtaatgaccgcctcaaaaca

tagcaagtttactttgtatgcattatcaatatctagtgagggatcgtgtg

aagttaggttgtttacttggatttgagcggtacccagtttatatttactt

gtgcctgacagagaatgtatacgctatcggacacattaactagaagaaac

taaaacaaactttgtaatcaaatgtaatattgccataactgtgacacaac

tagatttaaataccattctccaagcagacacggtcttgcgcactaacaga

cgggcaatgattcaattcaagttcatctggaaacaccaacatcagaagct

cga

 

approx 6 kb to next exon