nuclear RNA export factor 1

cDNA: Genbank AY648819

 

hi3248 is in the 1st intron

 

ctgcagcttgagggcaagaacccaagacaaatttcccgaactaggacaat

aaagtattaccttaccttatcttaccttatctcatcttaccttggttggt

gtttcctccatcacctcaacagacgatgctcctgtttttctggatgctcc

tcgtggtgcagagagcagtttgactgaggaggatgcagatgataagcaga

ggatggcaggagagaggaatgacactcaagaagaagaaacagcccagccg

cagtcatcagacaccagccttaggcaaaggcctggaccctggatgaggct

ctgagctacagccacatgacgtctgttacactcactcacagctcacacct

ttgacacattccttttgcaatgcacttagaattaccataagaatatttct

gatgcatttggaaaccagtttacctcatctagctgtttgagagcatttcc

tgttttgctgcttttgttttttagtttaatacttcctacaggtctcatcc

tgacatgctttaatgtgccattactgagctgtgtggttctgttacaatat

gagctctgcatgtaaagtgtaatcacattattagcattaacattttattc

aaaattctcagcagtcttctttactgagaagtttagcatttttacatatc

taagcagttcttgggaatggtaaataagtttattttacttcattttaagt

tgtttttaatgttggaaatgttgaaaatcttattttaagaggattgttac

ttatgaaaattaagttgtggactatgatatataatttattagggaataat

aatgttacatattgtgtaaaaataacattataagtattttaaatacatat

aagtttattatattatgtattaatattgtttaatgtctgagacgtaagat

gatgatgataatatattgttataaaatagcacactaataattgttaattt

gtgtaataattattagtattagaagtggtgttgttattattacaatacta

ttactatataaataatattgcaatactaaaagaaatactaaaactactat

aaaaagaaggcatatgatgcttaaccggtaatgttttgttacagatttat

gcatatattttctctttcaccaaagagttgctgttatttgtgttttactt

ttattccatagcacttctgatcatatcggaagcttattgtgttcatgttt

tgttacgctttttgtgtttatttaataaaatcatatatgatgtaaatgaa

aaacaaaagtcgttcgtcgtcgctcattgctgttgtgcaccagatggcgg

tagtgacgtgatgagcgaactgtccgctgggtattcgaagaagagtcagt

agtagcagctgcccagcacggaggcagattatttctggcacgaaacacgg

ataagaaagcatttcttcggatctttcagccgttcaaagtgttatcttaa

cgcctctctgtttggtgtttttttataaaactactaaaataacacctggg

agtcgtatatatcttacatttaaagtagcgtgaagccttctgaaaagATG

GCGACAGCAGACGACTCGCGCTACTATAATGgtaagtttgagccgttaac

aaaagctctcgcgtccatttcaatgccttaacatttgtatagttggatta

agattatacactgtcatactgcgtcccagaacctgttttctccttctctg

tattctccagctgtgtagcgttaggatttacataagttcatctagccagc

tagcttatttgtaagtcgccgttgtgtttttgttgtatgagctgattttg

accaacgctaaacgcattgtcttaattcttttagccgcattttgccgtat

ttattggaattacatagaaattattgagcgggatgaactggccacatggt

ggtaatgcgtgttgagctcgtgttgaacttatgtggtatcgtattgacta

acctgaagcaatgatgtcgagaccctaatgctaacaaaagaacccaaagg

agccttttggcaggttaactctgtgtactctgactatttgccataaaaca

ctcagaaaaatagtttgtgtatttaattagacaccattgaatatgtttac

aaagttatacaaatttatcaacgattattt

approx hi3248 (5-3)

gttgtattgtgagaggcaattaaaggcatagttcaccccaaaatgaaaag

cctgtcatcatttactcgccctcctctagttttaaacctctttcagtttc

tttcttgttgagttcaaggttagatattaaaaatacttgtattatagtgt

atttgttcctctatgaaagccaacttttttccaacttttcccataatatc

ttgttttatgctcaagagtggagagaaattcataaatgtttataaccatt

tgagtgtgtaaatgagaaaatgtttacgtgaactacctcttaacatatat

tagttgcacataatataagagctataaacgcataatactaactgtacttg

cttaaaatcatgtaaacacaagcttctatgatatctcagtaataaaatgt

cctttgtatatttatattaaataattgagagctattaagctataagtttt

aaattttaataatatgtgcatgattacaatttctaaagaaaaagcataaa

cacattaaaactgccactataatatatctaaaaatataatgaataaaata

aaggtataaaattttttccaaagtgggataatctgttttactattgtaaa

tagtgtatagtcaggataagcaaacattctgttcattttagtgcattttc

tgctgagcttttaacaggcttaatttttgaaaataaaatatattttttta

acagactagctagccagactggatttattactttgctatttaattctgga

agtgtgtgtttggttttaaggtgagaaaacataagcagaacaatgttttt

cacttgtccacttgtgctccaatcaatcaaaacacatactaaatggtaga

tcaccacaaaatgaaaatgcctcatcatttactcttccaccatatggttt

taaacatcttgagtttctttcttcagttgaacacaaaagatgttttgaag

aatgctgtttgcaaggattcataatcttcaatagtaggagcaaaaattac

catggaagtcattgggttttgtcaactctaaatggtttaggtgtaaacac

gtttttttttttttgtttttttttttttttgtttgttacagcaaaaaaag

tctacattgtagaccattttcaaatgctgattcttgcacttgttatatag

ttagcactaggccatgggccggtataagttttggacgaatataatatcct

tgaataaatataccacagtttgagtttgactacagctccaaaatgttttt

ttttatgtccgagtaaacaaacaatttttttcccccattgaataaaattt

cttttattttaggaaatatttataatattttgaaaccgtaaacatgtcaa

gctaaataattaaaataaatcattgatttctgctgtcttcattcattgat

ttcaaaaacacgtttttattgacaacacattaaaaaaaggtgagaaaaaa

aatacatagaccttataacagaaaactttgttttgaaacctcgacttttc

caaatcgctgtaaatcttgaaaccagttatcttcccatggctaattggca

catttgttcaaggattatgacacatcagttgtgtttgttaatgacacgtt

cacacctctgactctttcatccttcagAGCATGATGACCGTGTTGGTGGA

CCAAAGCATCGCAACCGTAAAGGCAGAGGCCCTTTCAGAGCCCCCTTGTA

CAGTGATCAGATGTCTCGTCCAAGGCATCGAGGAGGTCACAGCGGGGGAG

GTGGAGGAGGAGGAGGTGGCGGCCCTGGCCCCCGGTCAAGACTTCATGAT

GATGATGGAGACGTGACCATGTCTGACATCCCTCAAGACAGCTCGCAGCG

CAGATAgtaagcacttgtggatgcggaattctaat