notch homolog 1a

cDNA: Genbank NM_131441

 

hi3263 is in the 1st intron

 

ttgcggtgaaactaaattgtgtaagggagtgttcgctcttttcttttttc

tctttgagattggcattaatttgcaggaaatctccccgtcagtacctgcg

cggatggttactatttagattccgtcccgagcgtgagaagacgttactga

ggcgcgcgcgttccccgttcagagtcccacgcgacagtgacgtcagcgca

cgcgcacgcgcaccctcacgcgcgccgcacacacacacacagaatcaagc

gagagtttcccacgagcagcagccaagAGAAGACGCTCCTGAGAAACGCT

GGGATTTATTTATTAACTAGCAAGGATATTTATTCGAACTCTTCTGCACT

TTCTGGAGATTTAAAGAAGACTTCTGGGGATCTATGAGAGCTTCTGGGAG

GATTTTAAAGAAGTTGTAACGCCGAGGCGGAGTTATGAACCGTTTCTTGG

TGAAATTAACGCTACTGACTGCAGCATCGCTCGCGACGGTGGCACAAGgt

aacagtttaacactactctaacaaggatgcttcaattcacatgcttataa

actttgttttgtgcattattaattcatttggagaggttttgctggctaac

gtgaatgatgtttttgcacaacttgcgctttgagcgtcacttgttgcaca

gaatagtttaatattaggataaaccaaatattatttgcctcacatttatt

ttatggcatatactttgttttagtttttgcatgggtttgtgccaaagcat

caatctaaactgttgaaaaactattaatttaatactaaattaatttaatt

aattttttttattaaaaccaactgcaacaggaagatattaatgcaccagc

ccctctctcac

hi3263 (3-5)

tttgataaattattagtgattatattaataatgtattgcttgactgctgg

atttctgttaacgtttattatttagcaaactctcactttaaacttattta

aagttctctaacctcacagtttctgttattgcaatgattcacatgaccta

aaaaagcaactcaatgtcttcacgctgaagttgggaaacttctttacaac

tttatgaaactataagcacatgatttcagaactttagtggttgtttttcg

gtcttgtccctgatgttgattgagttgcattgtgtgtgtggagtctggag

gaaagcgatctgcgagtgaatggagggagggtgaggaggaggagggcttg

tcctgttgttctcgtgcgctggtaaacaatggctcga

 

approx 3.4 kb to next exon