splicing factor 1

cDNA: Genbank AY391459

 

hi3282 is in the 1st intron

 

ttctaaattgacgtcaaagctcctttgtcgatctcagcggacgccatctt

atccagcgggtgacAGAAGAAGGTTGCGTGGTCGGAGACACGCGTTCGTA

TCAATTGATTTATCAACAAAAGAAACGGATACATTCTGTGCaGATATCGA

ACCACGAAGAAGCCCCTGACGCCCAGAAATGGCAACGGGAGCTAACGCAA

CCCCGCTTGgtaagctgc

hi3282 (3-5)

acccgagcatcggcgctaagcgaggctttgactctggccccggtccgggg

ttaatgcctccgcctgggccttcggtgcctttcccgctgcagaacttcca

accgccacaattatcaaaccctgggttcccgcagtttcccggagccgtga

gctctgcgctctcaaaccctatcgtagtaggacagcagtctcaagcggga

ggcggaggtaaacaccgtggacaggccttgactccttcaggatcaacggc

ctccatttataaaagtagaatggctggttaccgtcattaatagtcttact

tgtttttacaatgccattgcataataaaaacctttgaaatgtgtaattat

ttaacatgtggttcatttgggggatcaaaacttaatctaacgttacacgt

taaagtattgtgttgtatttaacactgaactctgaaatgaaatacgatgc

agaaaaatctattgttttgaaatcgagcagtgttaacattagacaataaa

gtgcacactgttttttttaatatagatttttttttttcagtttagtgcat

aatatggtataaaaagggttgggagcttttacacagcaaatgtacatgcc

cagactgaacaaagatgtttattacattgcagtgtttatatggctaacga

tgttaagttaatataacgtggcatttagcagcaaactgcttgcttaaact

gctaaaaaccttagaatgctgtcttaaatatttcttaaattattagtatg

tttcgtaatatcacttttatggcaaagaataagtccttttccaggtcttt

aaagtaaaatatttcaacataaacaagagaggcaaaggtgaaaaattgat

ggaaatttcagacggcacttaagaggtttttgcatctgaactcttcatat

ttataatttctttttaatcaaagaaaaaatcctatgtttactttttaaaa

gtgtaataattcaataaattaaacattttgcatcataaagacatggtgaa

cgtttctgtgaagttttggtcttaatttacaggctttagacatccacaaa

tcagacataatggcttaatttgtttacatcccctgtcagATTTTGGACAG

AAGAAACGGAAAAGAAGTCGCTGGAGCAGCGAGACCCCTGATCAGAAGAC

TGTTATCCCGGGCATGCCCACCGTGATCCCTCCTGGGCTGACTCGGGACC

AAGAACGAGCTTATATAGgtgaatatctaaaatttgctattacaacatct

gtcagagtcatagagtttaggttgcaaataattttgtatgtgaacggggg

aatattctgtctacacccaaacaagtcactttttttttttttgtcccaaa

acttgtttataattttttttctcacagtttgcacatcacatgaaggatgt

aactgcttaatttcattagtctgacttctttgctgatacaactgatgtca

aattagtgaaagaacctttatgttaaagcaacagttcaaaacggtcatct

ctatatgtctcaaatgactttatagaaatggtcttctcaaagaagtcaa