leucine-rich repeat-containing 6 like (seahorse)

cDNA: Genbank AY618925

 

hi3308 is in the 4th intron

 

ctgcagttgtaatctctgaccgctaaggggcaggattgctacttgaatgt

aaaccgaacaaccacaataaaacttgccactttccttcattaaattacgg

ttaaagttgttttaCAGATAGTTGCCAGGAATACATGACATTGGATGCGA

TTTTAAGgtaattcctgttgaaatttattctaagtgaatattacttgtgt

ttattgcaccgctgaaattttcaacagGAGCGTATGAAGTGAGTCTGTTT

CTGTAGCAACGTCTAACAAACTAGACCAGCAAGTCATGGTCCGCAgtaag

tgcttcatgtattttaaacattatttgctttaaactaaatgttattttac

aacattgatcgtattttcctcacccgtaaacttttgacctttcgcggtta

agctgtttgtaaactaatcgcccctcttcctccgttcagTCAGTGAGGAT

CTGATCCGCCGCAGAGCAGAGCACAATAACGGAGAGATCTTCTCCCTTGA

GGAGCTTTCCCTTCATCAGCAGGACATCCAGAGAATCGAGCACATCCACA

AGTGGTGCAGAGACCTCAAAATCCTTTATTTACAAAACAACCTCATCCCT

AAAATAGgtaaatactggacagtgggattgtggtattgtagcaactcaaa

cgcatggctgttaatgtaaactcttgtaactttgtttttgcagAAAATGT

TGGCAGGCTAAAGAAGCTGGAATATTTAAATCTGGCACTGAACAACATTG

AGGTCATTGAGAATTTGGAAGgtgacttcatacagtgtatctg

hi3308 (3-5)

tgtgtgtgtgtgtgtgtaactgggtcaaaaatagattggtttctgcatca

aattaaatgtaaaaaaaataaattaaatgcaagtttatgctttagtgctt

taaatgcaaaaacaaaatatcataatatgggtgaaatgatcctccaatca

ttatttagcataacagatttattcataaaaaattgaaactatatatatat

 

approx 2.4 kb to next exon