neurofibromin 2 a

cDNA: Genbank AY561520

 

hi3332 is in the 1st intron, before the ATG

 

tgctcttctccatccagcaggaagagggcggcaaagaaaaccaacaacaa

agtcctggctaactccctATCCAACATTTTCTACTCAAGATAACATCGTA

TTTATATTCCACAATCGTCCAGTTAATAGTTTATTACCAAAATGGACACT

CTTTAAACGATTTCTACAGTTTCGGACAAGCTTACAACCATTTCCATGTA

GGTGACCGACGAAATCCGGTTTGCATTGTTGTGGTTTAGCGGAGTGCCTG

GAAACTCCTTGCTGTGGATCGGGCCTGGTTTAACACATAACCTAATCAAg

gtaactgactgatatttggctagtttcattcacatatttttaacagtgtt

cagaatggattatacttatcgtttaaacgtatactgtgtcgctgtaaagg

gagtaaatttgccagcttactttctgtcacgttagccaggatgtaacgtt

aacgttaagctttgtgagtcgctttctacattctcgctcgatataacaag

gcagattgtgttatatcttacttataaaggttgaaaactaacaatgtgtt

tattttaaggagagtgggc

hi3332 (3-5)

attgttacagttgttaagttacagcactttgcgtaaagtactcgtgaatg

cgacttacctgtggctgacttcattcatctgccttgtgatagtagcacta

gtacgttagataaatgatgataataatgatgcataataagggaaggaata

agttgaagtaattttctaattaaagctctgatagactttttaaaatgtct

aaattatctttttatgtatgtattgatgcactttgttttagtttttagat

atatatttaagtaaatgaatgttagcttcattttgttaaatgctaaatat

actttactatattgaggtattaaagtaattatttgtgttttcagGTGTAT

ATAAAGTCACTATGTCAATTTTGGGTCTGAAAAAGAAGCAACCAAAGACT

TTTAAAGTCAAAGTCAGCACTATGGATGCTGAAATGGAGTTTAGTTGTGA

Ggtaaacgtatggaaatacttaatacatgtgtctgtctgattctgtgtcc

taaaatgtcctacaaagtttaatgtttgtctataacttctagGTCAAATG

GAAAGGGAAAGATTTATTTGACCTGGTATGCCGGACCATTGGCCTGAGGG

AAACGTGGTTTTTTGGTCTTCGATACACAGTAAAAGACACATATGCCTGG

CTGAAGCCTGATAAACGGgtgagatgtaattgtagtttagagccta