bystin-like

cDNA: Genbank AY648821

 

hi3351 is in the 5' UTR

 

tacaaaacttgttaaatgtttttttatatgtttgcagtaaatgaagctga

taatcttacacttttttttatacaaaacttcgggaaaacctcgtcaaata

tccttatatttcatcttaaatgttagtttgaatgaacacgtgcacctgat

aataataacaggccttcattgtgttctacacaacactaataacagttttg

taaagtacttttaagagtgacatgtgatgtaaacatgtataaagcaataa

atagactgatgaatgaggagcaaaagcctctctgtgcattcaaacagcgc

tgaacgggagcatcaggagcaccagagagactcaaaacaagcacaactga

aaatattaattatttgaggacaatactttataaacaaaagtgtttctcac

cacgttacacccatttcttcgagacaaacttccgcaagccggggtattta

cttccggatcactcgagtttgcgtgaaacacgcgaaatcagtaaaagtaa

aacacttaaattcgataaaataaaaatattaacaatcattaaattcatgt

aatataaaaacattagccgcgctaaaaatgaacagagccgagatctgccg

agcctcgagcggaagtaaacagtgtgacgcagcgccgctctgggatcagt

agttctgcgcgctcaaaacagcgctcatctctccaactgctctcagagca

gcactacagacatatatctatgtatacacacacactctcagcgccattgc

tctcagacccacgtgtgtgcagctctcCGCGGCGCGTCATGTGTTCAGAC

GCGATTTCACACTCATAATTCCTCAGACA

hi3351 (5-3)

GACAGGCAGATAATACTAATATTGATAACCGTCATCATGCCGAAGGTGAA

GAAGGCCTGGAGCGGCGGCGCGGTGCCCCTGGCCGAGCAGATCCTCCAGC

AGGACTCAGTGCGCTGCAGCGGCCGGCAGAAGCAGCGCGGCCGCGGGCAG

GAGGAGCAGCAGGAGTTCGTGGATGAGAAGCTGAGCCGGAGGATCCTGGA

GCAGGCCCGCAGACAGCAGGAGGAGCTGCAGGACACAGCCGAGGAGGAGC

GCAGGACACCGGCGACCAGACTGGgtgaatgctgcactcactgactctct

ctctgtctgtctgtgt