solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1

cDNA: Genbank AY648822

 

hi3378 is in the 1st intron

 

ttgtactgttccttgtgtgaggtggtggatattttaatttatactattac

atatcacataacattacattattataatgagattatattttagtgtatat

taaataacatttagttatgtaaaatatatataaatgatgttatatatagt

ttattcgtataatttacttctagatatttattgggggcccccagatttcc

tggggccctacgcggccgcttacctcgcttattggttaaatccgcccctg

actgtacatacctgaaaggggctttgactatgttgtcgtgttgtacttta

cagtcagctgcccccaggtggcgacagagagcaacgtactgttggatgta

aatgagacggcacgtcaccgcatacgtctctgtaaacatggcggaagttc

agaggcgtcaacgtggggaggaagaaAGGCGCTGCGTTCGGAATGAAGCA

ATGTGAGGCGAGGAATGAAGCGGCAGGGATGGCGGACCAGACGCTAACGG

TACTCCTTAAACTCTCAGCTGCGGGCTTTTACGGAATCAGCTCGTTCCTC

ATAGTTGTAGTCAACAAAAGCGTCCTGACTAATTACAGgtaagaagactt

ttggctagagttaaatactcggtgtatttcaggagctggactggctt

hi3378 (3-5)

tacatccagagtacttggaatagttggcaactttagtgattacagcagta

tcagtgatgcagaaagacacatccgggtctgagtttttcccaaaccaaaa

tataagatgttattagattggtttaagagatatatcttgataatataatg

tttattttgtaaacttcagttatatcattgtaatgcaacaatattacctg

taagttagacttttgagtgtcttttctgtactctactgtacctgtatcta

actggcatgatggtcaaagaagaaaaggagttcaaaaacagtttttttgt

aatgtgtcttccgtttttttttttcaagtaacgtaagaaatatgaactct

catagattttttaaacacttagtaaaatgcaacttaatgcaacagtagct

gattcataaactgttttgtaagaatgattatcatttgattaaggtgaagt

tttatattcacacattc

 

approx 1.7 kb to next exon