splicing factor 3b subunit 1

cDNA: Genbank AY648823

 

hi3394a is in the 1st intron

 

gcgcgttcttgtaaacgagacgctgtcgtgaaaggccttccggtagtgag

GCTTACACAACAGCACGAAAATGGCGCAGATCGCCAAAACACATGATGgt

gagtttaggtttcaaatatttgcaagaagcatgtctcgttttgtagtttt

ttatatattgcattttgtgcttaatgccactttttatttaaaagaagtgc

attaagcgagaaatgagcaggattagaactggctaagcccgtgaatagaa

tatggcgtctggtcgttgaataaaacctggccgtggcgcacatataaaat

atcagcgctttttccgcattaagagtttttttgtggattatagcagagct

aattgtaatatacagtgctagaaaatagcattagcatgtgtctgttttgt

ctatgtagactacgtaatgtgaagatgtactggttaatcagtgatgtatt

gaaaccaaaatggcgttgcaaacacaaacagagcttttccattatgtag

hi3394a (3-5)

gtatgttccatagacgtttacttgtgatagtgtggttatttattttattt

ttgtagagatgtaacttgtattcattgtttaacgtttggcattttccatg

tttatgtataacacatggccgtgggtgattgtcctgcaacagtcattatg

ttaagcgggcttacgcacttttgttatattaatacattatgcaatgtttt

tatgacaatacctaagtaataataaaatataagttacatctcccttcacg

tattagttataaatatttgtaaggattttatatgtatgtagggacttctt

tttgtcttaatattgtgcatgtatggtttacaaatcattgtcttaaattg

aagagttaggattcaaaaatctctaaatgccaacttgtctcctaaaatga

gaattttgtttcagcctccttgttatttcactttaaagtcaatgaaaata

acttattcattactataacagtaacattactgagcctacacacaggagtt

agagaaaaatgctaattgaagaagaatatcaagcagcatgtagagatttt

ttgcatataaaactcatcgattgttgattttaataatatagtttcagaaa

aagaatttttgcaaattcttagtagggaaggcatatgactgtcaattaaa

tagtgctactgttttttttattattctttagggttagattaaatctcttg

tgttagtttagactgaatattcatagcacagtaaacaatatacaggccat

aatataaatataaaaatataaaaccagatttaccttagtttgttctatta

atagaatatgcagtttaatgtcagtgtgtattaaaggttccgactgtatg

ataaccttggataaaagtttgcaattactgctctaaaataagttcttttt

aaatatctgttaaaaaacaaaaacatttcactttgcccccctatatatat

atatatatatatatatatatatatatatatatatatatatatatatatat

atatatatatatatatatatatataggtcagacttcattagttaaaaaaa

aaaacagatttctttaaaatttaaatttggcatctttggagatttttttt

ctgctagagatactgttgtcctaaaaaaacgaaacgtaaaaaaaatccta

cgttacagaaaaatttggtgtttttttttaaaccttgacatttccaaacc

acggtataccttgaaaaaggttattgtcccatgcctaacatgtataaaag

tgacgttagtgatggtggaaaatgacttccaggtcacctcacctattata

atattagttaaaatgttttttgttatttttagaggactaatctctggttg

ttgttttttgtttttgttgtagACATTGAGGCTCAGATCCTGGAAATCCA

GGGGAAGAAAGCCGCTCTGGTGGTGGAGGGCGGTGACCAAGGAGTTGGCC

TTGATTCCACTGGGTATTATGACCAGGAGATCTACGGGGGCAGTGACAGC

CGCTTTGATGGGTATTTGACTTCAATTGCTGCCAATGAGCAGGAGGATgt

aagttatagcataacgctcttaaaagtaaaacaaaaaatacaactccatt

gtgtataagaattctgtttagtttcttgaacctaaccccaactattttta

ttttagGATGATGACGAGGATTCATCTACAAGTCTCCTTGTACAGAAGAA

ACCAGGATATCATGCTCCGGTTGCAATACTCAACTCAATTCCTCAGTCAG

ATGAGCAGgtaatttaacagactttccaccttcaagttgcagtgtgtgtg

tgtgtgttttcttgtgaagtttttgtatgtgtttttgaaatgtcaatttc

gaattgatcatacaattgtttgtacccattttgcagTATGATCCCTTTGC

CGAACACAGACCGCAGAAAATTTCAGACAGGGAGGATGAATACAAGAAGC

GCAGACAAAAGATGATCATCTCCCCAGAGCGTCATGACCCGTTTGCTGAT

Ggtaaatttcacactaccattctcctctgcttatttta