zgc:55687 (C20orf77-like)

cDNA: Genbank BC048885 (additional 5 UTR from ests such as CN176748)

 

hi3400 is a bit upstream of the gene

 

acaaagacaaaaagtaaattgaacatttacacaggttaaaatctccagta

atacttactctgagtggttcagttctgcagtttgtcagaagcataacgtt

atatgcactttcatattcattgtttttcatattcattcatttaatattca

ttcgaaataatttaatctacatcctacca

hi3400 (3-5)

caacgcaatgactaagctttctaaataaatgttttaataataactaaaag

acatcacttaggtataatagctaatattatttagagccaagagtacagcg

ctgtagcACTACCAGCGTGATCATCATGTCGCGTGTAAATGACGTCACGC

GAGACGCGACGGTCGTTTGTTTATCATCAACCCAACTTGCGACCAAATTT

GATCGTGTTCAGACATTTTTTTTAAAAGTTTCGAGGAATCAAAAGACAAG

TTTGCGTCTTATTAACGCGATTTAGTAACATTTCGGTTTAAATAAGCGTT

CTGACCCGCGGTAGTTCGTATGTGAATGGTTTCCGCGTGTTGTGCCACAT

TGAAAGTAAATCCAGATTAGCAACCGAACTGCTGACAGgtgagtatttat

ttatctttatttattaatttgcttcgcttgcttctttaatatgcattaaa

agctttt

 

approx 2.8 kb to next (1st coding) exon