claudin j

cDNA: Genbank NM_131769

 

hi340a is in the 3' UTR

 

caaatttaaagtgaataattctgacttcaactgtatatataaaaccagta

atgtcctaaagtctgttTTCTTGTCTCTGTGGTCTCCAGCCCGCTCCTCC

ATGGCTCTGCAGGTTTTGGGAATCACTCTGTCAATGATCGGCTTTGCGGG

AACCATCATCATCTGCGCGCTGCCCATGTGGAAGGTGACCGCCTTCATTG

GCACCAACATCGTGGTGGCTCAGGTGTTTTGGGAAGGCCTGTGGATGACC

TGTGTGTATGAGCGCATCGGCCAGATGCAGTGCAAACTCTATGACGCCCT

GCTGGATTTGGACCCCTTCCTGCAGGCGTCCCGCGGGCTCATAGTGACCA

CCATGGCTTTGGCCAGCTTGGCTTTCCTCATTTTTCTGATTGGGGCTGAT

TGCACTAACTGTCTGAGTAACCCACGGGCCAAAGGACGGATTGTGGTGGT

CTCCGGCATCACCTTTATGCTTTCAGGACTGACCACTGTGGTGCCCGTGT

CCTGGACAGCCGACTCCATTATAAGGGACTTTCACAATCCTGTAGTGCAC

GAGGCTTTAAAGAGGGAGATGGGAGCAGCTCTTTATGTGGGCTGGTTAAC

AGCCGGGTTTCTGTTTATTGGTGGAGCAATTCTGTGCACCAGTTGCCCAC

CGGAGCGGGACAACTATTTACCACGGTATACTTTAACAAAATCTGGCACT

CACAGTGGCTATGCTGTAAAGAACTATGTCTGACAGGTAACACTCTCTAA

AATAGTAGACTGAAC

hi340a (3-5)

AAAAATTATTGGATTTCCTAGTTTTTTTTTAGGGTAAACTATTCATTTGG

GCTGAATTTAAACAAAAAAGGTGATTTTAGTAATCAACTTAATTTGAGTG