exosome component 4, mRNA

cDNA: Genbank NM_200739

 

hi340b is in the first intron

 

agatctaaaacgctgcgattttgtaacagcagttcattggaagcgcttgt

actgggttactaaaaattaaaagtcctgctgcatgtacactattaaaggt

gttagtgtgaatatgttagtcttaatgtgctttaaaacaacaataagaag

ctacaaatattcaaagattgggtttaacataagtaagctaactctgccat

ctagagaacaacctaaaatacagtatgaggattactcgcattagtgagaa

ctcaaattaatccagcagatggcggtagaagatacacaaggaaagcaaaa

tccacagcagaagaagacctgtgcggaacaacaagaaGAAGTTCATCACA

CACACGCGTGTTTTCAGTTAAGAAGCGGAGAGATATGGCGGGTCTGGAGC

TGCTGTCGGATCAGGGTTACCGACTTGACGGACGGAAAGCGACCGAGCTG

CGGAAGGTGCAGGCCCGCATGAGTGTGTTCGCGCAGGCCGACGGGTCTGC

TTATCTGGAGCAGGGCAACACTAAAGCTCTGGCCGTGGTGTATGGGCCAC

ATGAGgtgtgtgtttgtgatgtcttgggtatgataacgttacaggtat

hi340b (5-3)

tacaatgatatggtgaattatgaggacatgctaataataaaatgcgacac

acataaatctctttttttattgaataacgttacaagaataataaaatcac

tgcattgaagaaaaaatacaataacaaaaaataagaaaggagagagagaa

ataaaaaacacagcatcaatcattaagaaaaaagattgtcataagcttta

agaaacttattattattaataagcttaagagattcaatattgtacgaaat

ttcaacaaggaaagtattaaaaataggtattgtttgtataaacttatttt

tcgtgtataaaaaatttacagtgtaacacaaaaaaccaagtgtgccgcaa

gcctacctttgagtgaaggtttcggccgttagatcgccccctgggggctg

gctgcagtacaagtcataaagcccgcctcctccgtgttaatgaaggagac

ttgagcccaaataaaaaaaaaatattacacttgcaataaaatgtcccgaa

agatagttctggtcgattaaggcactggttattgtgctgaaataggtgca

gatcctcatttttgtaaacagtttgtttttagcagtaatttaatgctggg

cgtgtcatcgtgattgacagctgtgattgacagtttctcaaagcagcgcg

tctgagcttcggcaggagactgaagtagactgaaatgttattattcgatt

tctgtgttattttaccgtgacaaaatgagttcagcagtaaactacagttt

ctgacatacatgatcctggtggaacactgtttattcgctaagttcagggc

ttttttcgggctttattagtttgctgatacacgcctagccacccagatag

caaaacacagttccggctagattctcgcctgccggagacttatctcttag

agctcagactgactaatgttacctctgctggacctactccggatgcctgg

actcactacccaattcccagcccgagtcaatcgagccagatgcggcggcc

gagcgagccggcgctgccgcatgtgagccggaatcagcccgcgacgccgc

gagtaagttatgtgttgcggcctggagctggcgcgattgaatatataaaa

ccctcatatttgttaacgttattacatccatttgtgttgatatgacagca

aacgcacgctgagcagttcggggggcgtggttgattttacataaagcgtt

tggttggaagctcgactccactcattttcgcggctcctcctctggctcca

tcagacagtccttctgcgcatgtctggctccaatttcagcagtcttttgc

gacagtttgtgcccgtcaagcaggcgttttgccctcaaggcgttcaatgg

gaaaaagggctgtcgcgtcgtccatattttttacagtcattgcaaaaaac

acataaatctcacagacatcatcagaatgtattatgatgtatttaaccaa

taactgtataccctgctgaaaaatccagcttaaaccagcctaggatggtt

ggctggatttaactggtcgaccaggctggttttagtgggtttttggccac

ttccagccatttccagcctggtcttagctagggctgctcgattttggaaa

aaatcataatcacgattattttggtcataattgtaatcacgattattcaa

aacgattatcagttgaagtcaaaattattagcactttatcctaggctggt

tcaagctggatttttcagcaggactatatatgaaactgggaatattttct

ctgtcagtggtcagaatgtcagtgggatctcatttgttattatttttaaa

ataaattaaaacaagaacaacacatttccgtatgtttttaagtattcgtg

gattcaatataataatataattcttaattagttaaactgtctaatataat

tgattaaaatggtgctgtgaataatagacaataattattacaaaacactc

aggccagaatctctgcagtaacgttgtccaacgtgtcggttatgtgtaac

atccaatattttatcatcgtttaactgaataacatgttggagttcatctt

tgtccctgtagATTCGAGGCTCTCGCAGTAAATCCTTGCATGATCGCGCC

ATCATCAACTGTCAGTACAGCATGGCCACGTTCAGCACGGCGGAGAGGAA

GAGACGTCCACACGGAGACCGGAAGTCCAGCGAGATGAGCCTCCACCTCA

AACAGACCTTTGAGGCTGCGGTGCTCAATGAGCTCTACCCACGCTCACAG

ATCGACATCTACGTCAAGgtacatggacttctttacgttcatgccgttta

tcatccatccactcacctgcccaattttgcatccaccaatctgtgcatca

gtcgttgatctattcttaa