intraflagellar transport protein 57

cDNA: Genbank AY618924

 

hi3417 is in the 1st exon

 

taatttactgtgactaaacatacagttctggcaacctagaaatcaaccat

ggtttgtactttgaaagtgtggtgatgataataattatttgttttccatt

cttattgttaacacacacgcatttattattaattatgttattaataaaga

gtcagtttcaaagaaccagcaagaaaagcaacatatcttttcgattggag

taacgttagatatggagtcgtttcttctccgctccagcgtgtggcagcac

tgtcagactacacacggtaacattataaaactcttagccaaaatcagatt

tcggctcgctgctttttttctattcaataattatgcatagtcattgatta

ttgattatttatagctttctgtttattatctgtgactattcagtagatac

ttttactttgtttgctgtcatggccgtcgctgtgtgtgacgtcattcctg

acgacagtaactaCAACATCCCGAATCCGCTGCTGCAGAATAGCCGTGTA

TATATCTGTCTGTATTCGTACCTGCAGTGTTAATAAAAGCTTTAAACTAA

TTTCCCTTTGCGAGTAAAGATTGTTAAATGTGAAAAGAGAAAGAGAGAGG

GATGGCGGAGGAGGAAGAGCGCGGTCCGGGCTCTGTCTATCAGATGTTCG

TG

hi3417 (5-3)

TTGATGGAGGATCTGCTGGATAAACTGAAGGTTCTCGATTATGAGCAGCA

CGTTCTGGACAAACACAACATCAAACCTCTGTCCAGgtaagagagactcg

gaatgtggattagaaagtatttgatgtaaatagcattacagttaaagtga

aatctctcatcatgaatttagtatcgggttttacaaacctggatgagttt

ttttcttcggttggacatataagataacattttggacaacattggtaaac

gagtaaagttagtttctggtccccattcacttttataatatggaacctgt

aagaaaatgaacgttgcaaagtagatagagttactttttagccgtcagtt

tatagtaaaatccacttatcatatattatcataaaatgaaaattctgtca

acatttactagaatgatggaaactatattgacaaaaatattatcagtcag

tggctgttgct