tRNA nucleotidyl transferase, CCA-adding, 1

cDNA: Genbank NM_001002159

 

hi343 and hi1167 are both in the 2nd intron

 

atttacaatgcaaaactattggaaatatgttatacatcgcagtttaacaa

caaaagtagaactaaatgcattgccatgttagtttgtgctcaaatacagc

ctatatttaaagctcactgttctcgcgatactttccgcaatccgatattt

gtgtttaagttcacattgaatgttacaaatactactttaatattgttttt

atagaatttctgcatgtaagacgctgtgcaaaggacttaccctacaacca

ggaatacaagtatagctaccaccagatagttggtttgatagtacaggagg

ttgctgaccactctgttgttccatttcgccaaatctcgtgtatctggttt

gccgaagcgatctgagccgggatagaaatcatcccagcctctcaaaggag

cgatttccactttagccatttattcagactgtgcggatgccgacagctgc

tctgaatgtaagcaacagcctgtcacttccgtcctctcgccagcagcatg

cgctttggctttaaatgggaggttacttcagatgtaaacaaatgatcagc

aaaaatgatcgcgtttgaatattagggacttaatctaatcatgcagataa

ggattcttattatcacacagtgtacgatatactggctgattgaattataa

agtaaactagtgattaacgagtgaaacgtttgcgctatggcaagctgttt

taacatttaatcgctgctaatatattttcatgctgctagctgctagttta

tttcaactattcggtttttagtgtattccaagtatgagaagtgcatgctg

tttttagtagactagtagttttatgctagttttttttacgctattcatag

gtagcctatcgctaatagctcaagatgtcagtgcttatattagatacaaa

ctcattcagtttcttaccaaggctactaacgtaagaatagttactctata

taatgaaacattaataccaaaggattattttcaacaaatgcaaaataatg

attcagttatactacgatttaatcaataagaactaggatctactaaaaat

gtaaggatatagattatatgttaaaatggcttgccataactgtagcatgc

tggatgggcgactgaaaaaaaaaataaaagtgctcagttttcattggacg

atcttgttattacgcaagtgtcccggaagcagttggccacgccCTTACGT

GAATGTCTGTCATGGCTGCTCGCAGCGTGAGTGAAACTACCGATGTGCTA

AAATAGCATCTGGTGTTTTCCTAAGgtgaataaatattaactgttgtgag

tcatgtttgataaatgcttagcatcgccataagtataataggtgttaaat

aatagtaatgcctagcatcttgaaaactagcattggagttgaaaagtctg

gaagataattactgaacattcaacgttataggtatttagcatgtatcatt

aacattaattcagtggcatgtgaaatttacagataacgactctcttgttt

taagGTCCACCGATGTGGGCTAAATTATTTCTACGCCCTTCGTTTGTCAA

CCGGGTTCATCTCACGTGGAGTTGCAGGGCTTTATTGCCGATGCAGCTGA

AAACTAAAGAGTTTGAGTCTTTATTTACCGACGGACTCGTTGGTCTTGCT

Ggtaagctcactttata

hi1167 (3-5)

aatgtcattggtaaaaacacggtgttaatac

hi343 (5-3)

ttcatgacaaataataattgcacatctactcacactttgttgctaacgat

accacaaagtttattcattcattcattcatttagggctttattaatcagg

ggttgccacagtgaaattaaccgccaacttatccatcatattttttatgc

agcggatgccctcccagtcgcaacccagaaacacccatacactcttgcat

tcacactcatacagtacactacagacaatttagcttattaaattcaccta

taccacatgtctttggacttgtgggggaaaacggagcacgtggaggaaac

ccatgcaaaaatgggaaggataaacggttggcacagaaatgccaactgat

ccaaccggggctcgaaaccagcggctttcttgctgtgaggcgacagtttt

aaccactgagccaccgtgttaccctaattcattcagttttgtgcaaacat

ttgaatctttaacattgtcatgtacctcacaacttaattagtgcaaacat

atccaaaccatgccatatttttttaatatctagAAATATTTCAAAAGAAC

CAGTTTGAGCTGAGGATTGCCGGAGGTGCGGTGCGGGACCTTCTGTCTGG

AAAACGGCCTGAAGATGTGGATTTTGCCACAACAGCCACTCCAGAGGAGA

TGAAGAGCATGTTCCAGACAGCAGGAGTCCGCATGATCAACAATAAAGGA

GAGAAACATGGCACCATTACTGCCAGGgtgaggtgaagcataggttatag

ttcttcaatgaattctgatgtccacatgtcaacgtaatgactctaaatgt

gccaatttctgcataatatagCTTCATGAGGAGAACTTTGAAGTGACCAC

ATTGCGAGTGGATGTCCAGACTGATGGACGGCATGCAGAAGTGGAGTTTA

CCACTGATTGGCAGAAAGATGCCGAGCGCAGAGACCTCACCATCAACTCC

ATGTTTCTCGgtaaaacacaaggagctatgaggatatatttaactagaat

tattagtcttt