ubiquitin fusion degradation 1-like

cDNA: Genbank NM_001002451  

 

hi3471 is in the 5' UTR

 

ataatacagatttataatagtgttcatgtaaaaggcgtgaagaagcctca

gcttgaaaaagagacgcgattggataacgtttggtttgttgttttgttgc

gtcacatcctgcctGTAGCGCACTTCCCACTGAAAGGAAACTGTTTGTTA

TTGAGTTGTCATCATCAGTAT

hi3471 (3-5)

TACTCCAATCATTGCTGAATTTCTGCTGTCAGGCAGATAAACAACTAATA

TGgtgagtaatcgattctgaactacctttacatttgcatttcagcattcg

gttttctattgtttgttacagtcaaaacaggctagctaatgctaagctaa

aaagcagtggaaagctgcactgtcactgtggcagatattatagaattgtt

tgtttgtgttattgaaatgtgaggaagtttattccaaattgattttagtt

gtaacctagttattaaagcaataatagtagaactaaataaataaatgttt

ctcttaggtatttgtttattaaatctagtcagacatatttagaagaataa

tttgatgacattaaaagatttggtgttacctcaagtagatttaattactt

aaaatgcaacaaaaaacgtatattgacttttatatattttagtaaagtag

aagtcagagta