ATPase, Na+/K+ transporting, alpha 1a.1

cDNA: Genbank NM_131686

 

hi3475 is in the 1st intron

 

aagtctgtactgttctgttctcccgcggctcttcttccccgtagaccccg

cctcttttcctccgcgttaccatgacgatccgtgcatacgtcatactgaa

aaaccgcactatatataagctttgaatgaactgactgtaacgcggctcgg

atgcGTGTCTGGGTGGTACTACGCGTCCGGCGGTGACCAAGGAGAGAATA

CATTTGAAAAAGCCCCAAAAAGAGAGGAAACGGGATCGGGGACTTTTAAT

TTGTTGTTTTGAAAGAAAGCTCGGATTTGTTTTATTTTTTGGGAATTCCC

AGGTGGTCGATTTTAATCAAAAGCAGCAAAATGGGACGAGGAgtaagtgt

aaacccaattgttgattcactttttatatcggtttgtccagttctgtgtt

tgaacgcagtgtttttaaagtgactac

hi3475 (5-3)

aaccacaagatgatcaactggtaaacggcttctcgccgttctagacttcc

gcagttttcatattcaaatgagttttaaatgaatgaaatgtgcgcagatg

ttcatctaaactacttgtgaagtctgttttcgatagtggagcaacaggtt

ttccagtctgtggctttaaaagggagtcaaactccattttaagacgttcc

tcgatcactagaaagatttgaggaatgtagcagacactaaacttcctcta

tggccgcggtgttacacggcctgtttgtctaagcagatatagttgaaatc

tcgtgacttttacactgtaaa

 

approx 4.6 kb to next exon