POU domain, class 5, transcription factor 1 (pou5f1 aka pou2)

cDNA: Genbank NM_131112

 

hi1757 is upstream of the gene

hi1940 is in the 1st exon

hi349 is in the 3rd exon

 

tgggtaactaagtattaggtatgtaagtattagtagacagtctgcttaat

atcttttgatactgctgctaaacagatatttaactgactataagaaactt

ttcatgtacatgtcaacttacactaaccctaaccccaacctaacagttac

ttataatgtaatgagaattagttggcatgcatgtagatgcaatataactt

aaattcaacaaatggaccatcaaaataaagtgagaccaaatttgtactac

tactaacaatataacttaagaataaacagatattctcaatgtcgatctgc

agaaagcacaatataactgcataacctcaagaaaaaatgaggaaaagtga

tattgcatgatct

hi1757 (3-5)

caaactcaatgtttgctgattgttcaaactactactttaaaatgagctga

aacaacacatttcttttggggattttaggggacaacttaattaatttttc

ttcaatccgattaaatttgtgaaaactaattaattccttcatgtttgacc

aacacaaaccgattgtgtgaaaatcagcattttaaacagatgatttgtat

gatccactgaaaaaatcttcaaagatgatatcttggatttaccaaattat

tttaagttaagtgctggtaaaaatttatttgggctgaatttaaacaaaca

aattaagtttaacattactatatttattttaattttaactaaatctgagc

aaattcaacacgtataaattgtttgcaacaattttgaaaaattagatctc

tataaaatgtatgcttatgcatattcaaaaaaaaactgaaaataaggaat

aaagataatttatttatcttgtgttattgattgtcttgtgtagctattac

aacctatgataggcctattagcatctcctgctaaattcctatttagcttg

tctactacatcatttcttctttataatagcctaaatgaaaaaataaataa

aaatcagattaattgtggttttaatagaacgaatagataaagtttttgta

aactttacacattttctaaatcagaaaatacatcattcatttattttaca

tgtttgtgcaattggctttattgtgtcctatgattaaaaaaaaacaaaca

ctgaacattacatcatgaaatttgattacattttattaaatctattaatt

tataattgaatgtacactgaaaaaataagtctgcaaaattgttgcacttt

atgtgttgaatttaaacaaatgaataaattttatattgttcaacttaatt

tgtttgtttaaattcaacccaaaataattgtttacaaccacttaacttaa

aaaaaatccacgtaatcatcgttgaataatggtgcactttaaagaatccc

ataaaattagatcccattatgatgtatatatatataggaattttctgttt

tgtgttaaacagaatgctgtatatatattgattcaaccttttatatatag

tttttaaggatgttttatatgtattttcattttgtattgcatgctgtctt

ctggggtttgcagccaaattcaccaatttgcaagcaattttattttggca

tgtaaaatggtttgatttatttttcagtattttctttctcactgataaat

ttacattagaactaagtttgccacatcacagcattgttctctttattttc

caaacactcttgcgtgtataaacggctcctatcagcgattcaacaagcag

cgtgaaggtgggagatgtgacgcttgtaatccaattgcttatcagcaaca

gacaaacatttcaccttttatttgtcactcctggtcaaaaagaacagcaa

aaatgcaagtgaaagcatttagatctactgtactttttttcctgatccac

tttgtttaatagcttataggcttcatttaataaaatctaaatgtggaaaa

gtgagttttcccgttgcgcatattgcataagtgttttcccacggatgtca

aagaattttaatatcaagggacagctcattaagtgcatattactgaaaca

aagtttacataatgtggcatgaatataaaatacatgaatttgcattgtaa

atactcgaaatatgcataagagggcaggaatgacaaaatgacggtgattg

ttatgcatttttatattcgtttttaaagaggttagtgaggttaatctatt

tttatttggacttttataagatgcaaatctatacagatacacctcgcatt

cccaaacatgtcctcgcccaatgagaaaaccaagttcattcacaaattca

cagtcagctgtagcttattgtctcgggtggccaatgggagaggagttggt

tcagacccctgcctccaactccgattgattagcaaaacctgtgtgggcca

ggatcagagctgagattgggaagAGTTGGAGGTGGTGAATTATTGGCCCA

TTCTGATTGATGGCCGCCACACAAGGACTGCGCACATTTCCACACAGGCT

GATACTGAGACGCGCAATCTGAGATTAGTCTGTTTGGATCATCCTGGGAT

GGAGCAACTGATCGACGTTTATTGATTATCAAACCAGCAGTCTTTACGCT

TTCTTGTTTGAAATCTCAACAACCTTTTTAGCGGAAAGATGACGGAGAGA

GCGCAGAGCCCAACAGCAGCAGACTGCAGACCCTATGAGGTCAACAGGGC

CATGTATCCTCAAGCCGCGGGCCTGGATGGACTTGGCGGAGCGTCCTTGC

AGTTTGCGCACGGTATGCTTCAGGATCCAAGTCTGATTTTTAACAAGGCC

CATTTCAACGGAATCACCCCCGCGACAGCCCAGACCTTCTTTCCATTTTC

AGGCGATTTTAAAACGAACGATTTGCAAGGTGGCGACTTTACGCAGCCCA

AACACTGGTACCCGTTTGCGGCCCCCGAGTTCACTGGGCAGGTTGCAGGA

GCGACGGCCGCCACTCAGCCGGCGAACATCAGCCCTCCTATCGGCGAGAC

TAGAGAGCAAATTAAGATGCCATCTGAGGTCAAAACCGAGAAAGATGTTG

AAGAATACGGGAATGAAGAAAACAAGCCGCCGTCACAATATCACCT

hi1940 (3-5)

CACCGCTGGAACATCTTCCATCCCCACGGGGGTGAACTACTACACGCCAT

GGAACCATAATTTCTGGCCTGGACTGTCCCAAATTACGGCCCAAGCTAAT

ATTTCCCAAGCTCCCCCGACTCCCTCCGCTTCATCCCCATCTCTGTCTCC

GTCTCCTCCTGGAAATGGGTTCGGAAGCCCAGGATTTTTTAGCGGAGGCA

CCGCGCAAAACATTCCCTCAGCTCAAGCGCAAAGTGCACCCCGGAGCAGT

GGGTCCTCCAGTGGAGGATGCAGTGATTCTGAGGAAGAGgtgaggttttg

cttttagttttatactattgctttagcgtgaacgcaacttgatagttttg

caattaacgtcttcttttaagGAGACTCTGACTACTGAAGATTTGGAGCA

GTTTGCGAAAGAGCTCAAACACAAGCGCATCACTCTGGGCTTCACGCAGG

CAGATGTGGGACTCGCGCTTGGAAACTTGTATGgtgagttcatggtctca

aacggtttcagtaattgtatatgaagttgtttaaacttttaacaggttgt

gttttctgtttaagGCAAAATGTTCAGTCAGAC

hi349 (5-3)

GACAATCTGCCGCTTTGAGGCTCTCCAACTTAGTTTCAAGAACATGTGCA

AACTGAAGCCGCTGCTGCAGAGGTGGTTGAACGAGGCCGAAAACTCCGAG

AACCCTCAGGATgtgagtacacttcataacaacagggggcgctaactgcc

gacggcctgtcaatgaacttgtgcgttatgtgctagcagtttcctgtgca

tcctgagtgcgtttggattgtgtgcgtgtttcacatagctactgtgtttt

tagtattgttatgagtgttttacaaactgtatttggtacctgatgcagta

ggctatagcagta