dJ383J4.3-like

cDNA: Genbank AY648825

 

hi3505 is in the 1st intron

 

agttgacgaaaataaaaacaagtaacacgcgtttgcccttgctcttagta

atctgttagtattcctgccttacTGCGTTGCATGATGGGAAAGCGGGATG

TTCAAATCTTCTTCCTGCTTTTTCGCTCGGTGTGTTGTTGATCGTCATGG

AGGGGAGAGGCAGgtacgaaagagttttttatgttgtaaaatcatcatta

gacattttttttgtacggtagaatagttcatttgaaacacaacacgtttg

agcgttaattcggaaacggatcatgtcgtggtttagcggaaagctgctaa

tagtaacgttagcagttttctgaacgctgtcttttgttttgtttttttgg

tcaggttgtgtttaattaaaacggctagccaaaccttttcgtatgaaggg

ccaaaaaccgcacatcattgattgccgcgggtcaaagatgaatataccga

attataccaaaatattttacattatagttgccatgtgtcatttcttaatt

catctcataatattaaaaaaataaatagaaaacagtata

hi3505 (3-5)

acagtttagtagtgcagtataacctttttgtaattataacttattgcaat

aaagcataaacaattaaatttataacacagtagagtttaatgctgaatac

actagtcaagcagaaactgttttccttgattcgttcaccaaagtctctcc

attttcctccatttgtcatatgtacattttaaaccacctatctgattaat

ttacaccatttaatttgaaacatttaatttctgctttttgtagcttaaca

gtaaaataacccaaaaaaggttacattcaatttgaaaagacctttctgca

tactttccgcattcttaatttgccctttcactatttaaagccattaaaag

gtcttcaataacaccgtaaatgtttaactttactaaaatgttgctttgac

tgctaaaacaaatcaatgtgttcctctgtttttgttttcagaatacattg

caaagctctcttaaccctttgatgcacaagttataaaatagataaagaaa

aaaaaacttaagacgggtcactttagacctatgtagtgctcaaagggttg

aataaaacgctttaactagattggggttaagttggttttatattcgcaca

ttcttctttataatataatttcagaaaaataatatttgctaatactaaat

agtgaaatcatattcgcagcaaatgactattgaaatgaaattgaggtcaa

gttggttttatatttgcacattcagtctttctctttaataatataatttt

atcaaagtattttttgcaaattctaaatagtgaaatcatatttgcagcca

atgaccatcaacatacaacatcgttaagtcaaatgaatagtgctaatgtt

gttgtaaagtcatatttacatgtgattagaggcagaatattcaaagtacc

atggtatacaatatagggagaatgtcacaagttgtcactgaatgaattcg

caaatttaaaaccaactttacctcaattaaaattcaacatcgttcacagt

caaataaatagtgctaatgttgttttgaagtcatatttacatgtgatttc

agaactagtattcatagtaccatagtaaactatataaagagtgtgtcaca

agttgtcactgaacaattacgcgaatattaaaaccaacttacctcagttt

actaggtgtctgtcaattgagagtttattttcaaaataaatctcagtgca

gaaagattttttttctgtttgtgatgagcgatcataaaggtcatattaag

cgttttcaaggaaagtaaaagaatcttaatttagaaatgttaatttgagg

tagttctgcacgatattagaaaaatctgacattgcgatattttattttgc

tgcgatataaaacaatttcagcatatgacttgaatagctctatttggaat

aaaattatttacttagattgatcttgtagtggagtgaatcaaagaaattg

gtggataaataaggtggagcacagataaaagcgaagtagtcagatattca

ggtacagtaatacgatacaatattatcatgatcttttgcccctgataatg

atagatcatgatatcagtgaaatatcacaagaaaatcatccacaatatac

tattaaatatttgtaaacaaagagagagaaaaaaatcatcaaaacgttat

atgtagttagatgtatttcttttactaacagcacatatatttcttagaat

tgcaacattaatatatgttcgattcatgcacatcgctattttgtcctgcc

cctaatgaataatcaaatgtaatgtaaaatataaacactacattcttcat

tgctgatcaacaataataatctcaactgcacattgcaaatggtgcgatgt

gactgttataaatgcacatgttacgatttcgatgctgaagtgatatattg

tgcagccctaatttgcggtattatttttgatgggcaaactagagaataaa

ttataataaaatgcatacatacataacctatttatattttttttagagct

taagaaatattaacctttaaagaattaaaaacatttttgtgtgtgcgttg

ctaatgcagtaaaacttattgtgtaatccctattaacttgcattagcgaa

cactataaatgcaacaggtaaaatatagcaagtaataaatattaatgtat

tgtgttctcctcgaaagattcattcctttacttacatttatcttaattca

ataaaccttcattttaaccatacatttgtgacgtataacatatttagaaa

tgaacacttgttatgtaggtcccattagcagtaaacacagcattattaac

atcctttgtggcttttattacccaaacagTGCCGTCAATACTCCTGCCAG

CAGAACCTGTACTCGTAAAAGCAAAAGTTATGGTCGGAGCTGTGTGGAAG

CACCATCGTATTTCTGGCAAACACCTGGACATTTAACAGTCCTGAAGGTC

CCAACCAGTAGAGGAGCTGCCAAATCACAAATCATCACTgtaagagatta

agatggaaacatctcattcagtcagtctgaaaattctgttactgacatag

aatgcattgaataactaacgtctttactctttctacagaataaggt