thymidylate synthase

cDNA: Genbank AY005804

 

hi3510 is in the 1st intron

 

ttttcaagatgtctgactgttacccgccaaaaatctaaaagaagaagaag

acgaacagtttcgcggcaaaagctccatCGCCCTTGTTGTGCTGCAGGAT

TTCGCTGTCGTATATTTCACTTTGTTTTAAAACTAACCATCATCTCAGCT

GAGGAAAATGCCCGACACGGCAGTGGAAGTGACAAATGGACATTGCGTTA

ACGGAGAAAGCAAGAAAGAAGAAACAAACGGAGGGAAAAAGGAGTTTTCT

CTGTTTTGCGACGAGCGCGGGTATTTGAGTCTGGTGGAGTTTATTTTGCA

GAATGGAGCGAAGAAAGGCGACAGGACAGGCACAGGAGTGATCTCTGTGT

TCGGGACACAAGCTAGATACAGTCTCAGAGgtaagtcacatctgttaaat

acactgtcattgcatttaatctcactggtgagctttataaatcaaatgaa

tgcaagcctactgggagatcagggttgttgctagaagggatacagctgcg

gccggaagttaacaagaattatttatattgttgaattatccattaattgt

gttttattaacatctacctctatcccaacctccaaagtaatgtaaaaaca

gcaaatataaagagagttattcataatatttattcaattatccgttaaat

tggggtttattaacgtctaacgttatccctaacgttacacataccctcac

agtaatgtagaaacagcttttataacgagaattattcatat

approx hi3510 (5-3)

tgtttattaaatttaccttaatattctgttttattaatctctatccctat

ctcaaccctcacaataatgtaaaaacagcaattataaggagaattattca

tattttattaaattaaccttaatattctgttttattaatgtctatcccta

tctcaaccctcacaataatgtaaaaaacagtatttataatcagaataatt

cataatatttattaaattacccattaaatagtgttttattaatgtccaac

ccaaacccaaccatcacagtaatgtaaaaactgtatttataacgagaatt

attcatattgtttattaaattacccattaaatattgttttattaacatct

acccctaccctaaccatcacagtattgtaaaaacaataattataacaaaa

aatgttcatatttattaaattgtctattaaattgtgttttattaacgtct

acccctaccccaaccatcatagtaatataaaaacagtatttataatgaga

attattcatattatttattaaaatacccattgaataatgtttattaatgt

ctaaccctaccccaaccatcacagtaatgtaaaaaaacagaaattatagc

gagatttatttatataatttaacatctacacttatcccactcctcacagt

attgtaaaaacggtaattatttcgagaattatatatattattcattaaat

gatcaatttatttttcattaacgtctaccccaacgctgaaacgtttataa

aacacagtctgatcataagctgtgctcattgtgcaccttgcagATCAGTT

TCCGTTGCTGACGACCAAAAGAGTTTTCTGGAAAGGCATATTGGAGGAGC

TGCTGTGGTTCATCAAGgtgggaaatatcgcaaacgttttgtttttattt

atttagaaatatatgtaaatgtagtgttgttttttggtcatgaaatttgt

ctttttttttgcattgaattgctttttatttcttcaattcagGGTTCAAC

AAACGCCAAAGATCTGTCGGAGAAGGGTGTGAGGATTTGGGATGCTAACG

GCTCCAGAGAGTTTCTGGATAAGAACGGATTCACCGATCGGGAGGAAGGA

GATCTGGGTCCAGTTTATGGATTTCAGTGGAGGCATTTTGGAGCCGAATT

CAACTATATGCATACTGgtgacctttctgatattgaaaatgaaacaatat

ttagctttttagagagctgtgtagtaaatgagattaatt