putative breast adenocarcinoma marker

cDNA: Genbank BC045320

 

hi3512b is at the splice donor of the first (all 5 utr) exon

 

cagaaacatctagctgtatattatcattaataaatgagccaacatgtttc

caaaattgtacagcataattacaataccaaacacaaatacagcaagagga

aaggagaacttatgtatccgtgatatttccaaaataattatcataataat

ccaataatccatcacttttcttgttattaaccagtctaagagatttaata

aaaccataaattattgaactgagtcatttcttgttgatggaaagtaattt

atgacgcatttcctatgacgtagccctatacaaaggaagtattgacattc

atacgcGGAAGAAGCTAAAGTGGGGAAAACAATCGGGTGGATCGACGAAC

AGTAACTTCAATAAGAAACAAACGAGGGCGTGATATTTGGTCTGTTCAGC

TGTTGGTGTCTCCGGTGGACGTTTTCCACGTAAAGAAAAGTCAAG

hi3512b (5-3)

gtactaacgagagagatacaggcctctcgtttttatttcttttgacgagc

taagtttagcagctgagctcgttacaattatttgggatgagccttcatct

ttatgtaaaatgccattcaattaatacgttattattcaacgtatgagcgt

aaatatttgtcttttttaatctagcaagtgtttgtagtcctaaattgttc

ggttcattgtcattgacagcttatctcacacatatgtactaattataaag

gcaaaatttgctcaacagtaaaactgagagggtatattttataatttgac

attatttactcaattggagaggtcacttgattcatgtcgtgtaaaatatt

ttaatttgagagtaaactcagctacactcaattagctcagtcatgcctca

tgacatatctgcaaaatatgatgtcagcatcacgtgtctgagagtcattg

ttatcaaatcacaggtgtaaacctgaatttcttttttaagatttaagtgg

gtgacacggtggcacagtggttagcactgtcacctcacagttgaaaggtc

gctggttcgagccccagctgaaccagtaggcatttctctgtcgagtttcc

atgttctccccttgttggcgtgggtttcctccaaaacgcactatgcacta

tgggtgaattgattaaactaagttggccgtagtgtttgtgtgtggataag

tgtgtataggtgtttcccagtacttcgttactgctgaaagggcatccact

gtgtaaaacatattctgtataagtactccccaattgagtaattaatgtga

aataatgcgacccatgatgaaaaaaagatactaagccgaaggagcataaa

tgaatgactttagtgccatttggatgtttaacagatcatggaaacactta

aaattgtcctcctaattgctctctattttgttcgtcagATGGAGTTCCTG

TTTGGAAGGAGAAAGACTCCTGAGGAGATGCTCAGACAGAATCAAAGAGC

ATTAAATAGAGCCATGCGGGATCTAGACAGAGAACGGCAGAGACTGGAGC

AGCAGGAAAAGAAAATAATCGCAGACATAAAAAAAATGGCCAAACAAGGA

CAGATGgtaatgaggtgtcatttgatatttggttgacttttttacactcg

tttacaagcaatattctttctcctgtagGATGCTGTAAAGATCATGGCTA

AGGATTTGGTTCGTACAAGACGATATGTTAAGAAaTTCATCATGATGAGA

GCCAATATTCAAGCTGTCAGCCTTAAAATTCAAACCCTCAAATCAAACAA

CAGCATGGCGCAGGCCATGAAAGGAGTCACCAAAGCTATGGCCACCATGA

ACAGACAGgtactgtacagccgctaaaaagtcctgccaacagatagtttg

ttcttatgcgtgcgttgatatttattccttttttctcttaatacagTTAA

AGTTGCCACAGATCCAGAAGATCATGATGGAGTTTGAGCGCCAAAGTGAA

ATCATGGACATGAAGGAGGAGATGATGAATGATGCgATTGATGATGCGAT

GGGAGATGAAGATGATGAAGAGGAGAGgtgagcatgaataaatgtacatt

tttatgaatatttgctaattgacaccaacactttttgcattattcttgta

atgtagtaaaatcaatacttgaaatcaagtaaaatattatttaattaaaa

cccgtgtctgaatatacagttgaagtcagaattatt