polymerase (DNA directed), beta

cDNA: Genbank AY648826

 

hi3512c is in the 1st intron

 

gtaatgaaggtttctgattgggtagcgtaggcataacgggcgtgttgtgc

ttctaagccccgcccccactattttgcgtggctacagtgctaatgctaag

GCTTTGTCCAGTTTTGTTGAACGCCCGCTCAGCTGCTAGACTGTAGAAAG

TGAAAATAAACTTCTTATCCTTTAAAGGGTCAAGCTATTGTTTAATATGA

GTAAACGAAAAGCGCCACAAGAATCCCTGAACGAAGGAATCACTGATTTT

CTCGTTGgtaagttttgaacatgacagctcagggtagcatgtggctaagc

tagcaggacctttaaatgtcgaatgaatgaaaatgtagatcagttttatg

gataaaaatcatgtttaacatgttaaaaaataagatgaagtgcattatta

gacctagctttaagcttcaatcaaataaaacggcaaatataaccatttat

agagtttaattttctctgagagtagggtcgagatcagtgctgcatcaaca

aaacaataacatacag

hi3512c (5-3)

tttaatttatgtttaatgaataacaagtgtatttaaaattgattcacaac

taaaaatcggcagttttgtttatgtttcttttcaaatcttttctgttagc

acaatcataatctgattctcatgattgttttgtctgtttattgaataaat

gtcaaattatatattattttaaagtccttcatctaatataaagagacatt

gcaaaactcttagccttgatgattgtgttgtttgtttcagAGCTGGCCAA

TTATGAGAGAAATGTCAACAGAGCCATCCATAAATACAATGCTTACAGgt

aataattcacagagtc