phosphoribosylglycinamide formyltransferase

cDNA: Genbank BC047808

 

hi3526b is a bit upstream of the gene

 

tatatatgtatatgtgtgcatgtatatattcacatttatatgtacacagt

gcacacacatatattatgtaaatacaattttttttattctggatgcaatt

aatctagtttagtctttgcaccacactaaataacagacaagaaatgtcta

gatcatgtactgcatgaactgccatgatgcatataccaccacaaatcatt

ttaaaattatgtaatacaccaagtattaatatgaattgttcaaaaaactt

gaagttttagagacgaactttagtgtttatgtatttttatttgtaattaa

tccaaatatctgttcagaaaatgttcattaggctaacatttcacccattt

taagtgagtttgaagtcatgcagttcttgaattctttattggaattttta

aagcagaccattttggaaaccatgaaccatgtgtgtcattcattttgctt

cggtttagtccctttattcatcaagggtagccacagcggaatgaaccacc

aactattgcagcatatgttttacatagcggatgcccttttagccacaacc

cagtactgggaaacacccacacacacacacattcatacaccatggccaca

gcgctaaccactgtgtcgcctaaattgtgtgtgtttttattttttcagtt

catgaaacttatctacgtttaagttttatgtttgaaagcatacaaattta

catataggctacggattttattaataattcccattatatcattgaaacgt

caatttaaaaggtgcacatttcaaacatattgacataaactacatttacc

acaattctctgcgactttgacaggaagttgacaaacctaaaaatcctaca

atcttgagacagaaacataacgagtacataaaaactcctatatattgtat

gatataacaatcactcttacaatctcgatccacactgttctcttaaacca

gtagcgttatctaaaagaactgtttattaacgtcagagtcattttgagcg

actcgattcattcagacagctcggctcagttaattaatttgcttaaaaac

tttaataaatctttctcatttctttcctaaaacacatcatagtataaata

caacattcaaaacatcaaaaccagttcatatatgatatcagtt

hi3526b (3-5)

taaccgaaacgcatcacaaggaaagaaccgattcagaagaacgagtgatt

cagtgtgccgagcagcgagtgttgagtgtgtgcacgtgGTCAGTGGAGTG

AGTGAAACACGCTGGTCTTCAGTCCATCACCATCAGAACTCATTCAACAA

CAACTCAACAGCAACTACAGCCCACACTGAAGCCTGCAGCTCATCAGAAA

CAATgtaagtcaacact

 

approx 5.5 kb to next (1st coding) exon