ribophorin II

cDNA: Genbank BC046052

 

hi3583 is in the 1st intron

 

ctgcagcgcaagcaactttcgaacacgccacgtgatttgggacttcgtgt

atctcattggctagaaagagaaatactggaaacggccaattacaaacaga

cacaaagcacaccaccaacattccgtctttttctactcaagcctgtttat

acgatcacacaaccgtttatttcattacaaaccaacatcgtaggtttaaa

aaaggtttcaactttaacgtttattataaagacgtttagatgtttatgaa

ggtttctttaatttttcattcattttagcctgttttggctcacaccatgt

tagggttttttttgccttcttttaatgctcagttcgtgattttgacacac

ttgcgaagtttgtatttataaaatatatgtttacacattaagtagattgt

atatctattgttgttcgtttgtaatgcctggttatgtttgtcattaaatc

aaataaccacatatttcacccccagcagtgaaataggtttcatccgcgtg

acccggaAGTTCTCTCAGCTGGGTGACGCTGCATTAGGCGACATGGCTAA

TCTCTgtgagtacaatttatgctcgttttaacgctatttgttatcagatt

agtgtacatcaaatcactttaagagcaaacagttattggttgatgacatg

tttagttgctttactgaatgtaacgttagtttcatagatttcgtctttat

cagttcttgcagccagctctcaacagcccgtctgtaactgttactttaat

tcattacgcatgattgttattttatttttttaagtttacgtatgtgcgtt

atatttatccaaactggtccgtgtacggtccgtgtatcatccg

hi3583 (3-5)

ttcatttgattattcctttttttacggaaaacgaaacatcagaaaaacga

tacatatttcgtttttctgtttattctgtaggcagaaaaaacggaaactc

atctgttattctgctaattaacttaaaacgaaatattaaaacaaacacaa

aaccaaaacgaaataatgagtcaaaaaatggtc

 

unsure how far to next exon