proteasome (prosome, macropain) 26S subunit, ATPase, 6

cDNA: Genbank AY648827

 

hi3593 is in the 2nd exon

 

tcggtttggtttgtgacgcgctactattaaacatcacgaagaagcGCGAG

AGCGAAGCGGCAGTGAACATGGCGGAAAACAGGGAGAAAGGTTTACAAGA

CTACAGAAAGAAATTACTGGAGCATAAAGAGATTGACGGGCGCCTCAAAG

AGTgtaagttcgatgtttttctgttcacgtcagactgtcattgagcagtt

tgacatcttcataggctgttgtttgcgttatctcagcagcctgtactgta

agtcgctttgtcatgcagtgctgaaatcaattagccgctaatggtaacag

ctgaaataattcgtagatcccctttaaattcataattagagacacacaac

atgattatacgtatctcccgatctgaaaacatcatatattttaaaaaaga

gccttcaatacagctgttttccagtatcatgctatctcacgataacattt

agcatctctgacacatgaagctgatggaagttgaacataatgtttgcaca

tgtaaataaacgctctgtgttgcagTGAGAGAGCAGCTGAAGGAGCTCAC

TAAAC

hi3593 (5-3)

AATATGAGAAGTCTGAGAATGACCTGAAGGCTTTACAGAGTGTGGGGCAG

gtaagatctgctctgtaaatcattgtttttcttatttccacattagggat

ttgaacatatcagtgcctttataacgttatttaaattgctgcattgtctt

tgtagATTGTCGGTGAAGTGCTGAAACAGCTGACTGAGGAGAAATgtaag

gccagattctctttattaagctgtagataattatagtttatgtctatctg

ttcattgtttaatgtattcttcttttg