ATP synthase oligomycin sensitivity conferral protein (zgc:109976)

cDNA: Genbank AY648828

 

hi3619 is in the 1st intron

 

tatttcatcccagaccagtacgcatgcgcagttcttttgacctacacaGT

CGCAGGAGAAAATGGCAGCGCTTGGAGTGGGGCTGCAGgtatgactttct

gaaaaccttgtactcgctttatagaaaatcaacaaatgtgtgccttttta

ttcataacactatgtaaacagtaagaattgtaaatatttgagtggttgga

acgaacgtgatatgtctggaaactgagcgaggccttgacaggcagtgtcg

aatccgcaacagacagtcattcaaaccgtgcgctcttgtagttcgttaca

tagt

hi3619 (3-5)

aaataatgttaatttgcgtatcaccctttcaattgaaagcctttatttac

ttgtttgtaaagtacaatgatcaccaaatgagtttttgcttctcaatgct

caatctggagtatgcagcgctcaaaatgtgactgaacatgcgttttaaac

tctctaacgttatatcatgcagtgtagtggcttttgtgacgcagtgagtc

atggaccatatatctatattcatgattttacagtttgcaatacttgataa

atctgcaaataattgttttcctcttcctgcagGTGCGTCAGTTCAGCACC

TCAGTGATCCGACCAGCAGCAAAACTCATCAAGgtaaataataacatatt

caaatgtgtcattctcacaaaattaatattaaataccaggtaggcgtggg

ccggtataagattctgatggtatattaacctcggataaaaatatcacggt

tacacaatattggggttactgctagatcattgacttctgttgtcttcatt

aggtttcaaaacaaatttcattgcagtttaaaatggcatcttgcatatct

tttctgctggagttattgttgtcctaaaaactaaaacaaaaaaaaatgta

catttaaaaatctgatatataccataggaatggtatagcagaaaatttgg

tcggttttaaaaccttgacttttccaaaccatggtataccttgaaaacgg

ttatcttcccatgtctaatatctggaaaaaaaactttttaaaatatttta

gtatcattcagtgtcagtgttgcataaatttatttattaattttaattct

tatgcaccaatgcatttacgatcataaacatttttgcaatatgtttttgt

atttatgcagacttctgtggacttaataaatctgtcacctcaggctgtat

ttaaatggtagtatattttttcagCCCCCTATCCAGGTCTATGGGGTCGA

GGGACGCTACGCTACTGCCCTGTTCTCTGCTGCCAGCAAGCAGAAGAGCC

TCGACAAGGTGGAACAGGAACTTGGACGTGTGTCTgtgagtttccctgtc