EBNA1 binding protein 2-like

cDNA: Genbank AY648829

 

hi3625a is in the 5' UTR

 

ggggccttacaagacaatgtgcccaggggcccctgagttcttaatccggg

cctgactgtggtgacccctgatgcaaaaagggactaagtcgaaggaaaat

aaatgaatgtatgaataattcaaatgaaataaagtgtaaaagttcaaaaa

ataaaaagaaataaagttcaaattcagattgtttgtgcaaattttaagcg

tccatagtgaactagactggaaagacgaatataataaataagaacgaagc

ttaagtaaaaacagcagatggtagtaatgcattttatggataccagctga

aagaagaagacgaagaagtagcagaagcagctgcagctgcggaaccgttt

gttgttagtctgtgtttccgtcaggactttgatttacaaacacttgtagt

gtgctttcCACATGTGAAGTATTTTGTGGCCGTACGTACGTTTGTATTTT

CATTGTATATTCTTT

hi3625a (3-5)

GACTATGATAGAAATAGACGAGGATCCTCAGTTGGGGTTGCATTTCGACG

AAGACGACGATGAATTATCTGACGACGAGgtaagaatatgttccgcttca

cacgtgtttatttcgggcatggtagaatagtatttatattacttggacat

gccaacgcattgaggcaaagttgtttttatatttggacgttttctttaac

aatatcattttagaaaacattagactgttagaatgttagtcaaaataatt

aagaaacgttttcagattttaatagacatgtctaataacttaatgctctc

tgttcagCTGCAAGAAGCTTTCGCTAAGGGTTTGCTCAAACCTGGATTGA

ATATCCCTCAGGATGAGCAAAAGAAGACCATCAACAATGTGgtaagttga

ttagagctgcttttacacggtttagttaataatacgtttaacatttatac

tgaaaggcatgtgtaaaaagcacatatgcctttaaatattgttttattgt

tgttgtattaaagtgttttgcatagggaaaatagaaataagcaaggttct

tcggtttgttagattatgtagaatttgttgtgtaaagctttattcatttg

tgtgtgtgtgtgtgtgtgtgtgtgtgtgtttatttatttattttttgctt

ttataaagcttttgatgctcttgagcgcatttaatttacagtagttgcac

aacttcaactttgatatattttcttaactccattcgcacttgtaaaaaaa

tgttacctgctccattaatcttaaagtcccctataatatttacagaagtt

ggtttgagtttctctttgccttttgtaaaagcaaccaaactttttcctca

tttgttgaatagtagtttacaagctattatttagatcagataatcatttt

cttataaaccaactaaaacacgacaccactcactttctgaaggaagagtc

gcagatct