WD repeat domain 36

cDNA: Genbank NM_199566

 

hi3630a is in the 5' UTR

 

cagttgaggtcaaaattattagccccctttgaattaaataattctcaaat

gatgttttaatgagcaaggaaattttcacagtatgtctgataaaaaaatt

ttcttattgagaaagtcttatttattttattttggctagaatttaagcag

tttttattttttaaaaactaatttaaggtcaaaattattagcccctttaa

acttttttttgatagactacagaacaaactataattatacaataacatga

aaaaaaatcctctgcgtcaaacagaaagtaggggaaaaattaaacagtgg

gaaaataattcaggaggctaataattctgacttcaactgtatattgatac

atatattgtttaaatttcaagtgtttgttttattttatttaaacaaaact

ttctgattgacttaaatttaaataattaagaatcattacttagtgaagtg

attactttttttaagtaacttactggtaggaaccgaaggaaattgtttcc

acacgacccgtgtttagcgtagcACTGTTTTGCTACTGTTCTCTGCTGGT

ACAGAAATGTGCCTGAAA

approx hi3630a (5-3)

GTGCAATAAACGTTAACCGGGATTTTGAGCACAGACAGCGAAGATTAAGA

TTGTGCTGGCGAATATACATGAGCAGCATGTCTGCGAACAAAAAAGGGAG

CGTGATCTTCTCTGGATTCAGGGCGCTGGGGCTTTACTCTAATCATCTGG

CGCACGTGGTTCGCTTCCATAAGAAACACAGAGAGTTCTATGTGGTCACT

GCAGTCGGACAATGTTTCCATCCATATAACGTAAgtgaatacctgtttca

tgcttggtttgacatgatttcgaacgggtttatggttgttagttaccata

gtaattaagtattttaagcacacatttttgtatttta