topoisomerase (DNA) II alpha

cDNA: Genbank AY648832

 

hi3635 is in the 1st intron

 

TTTGTGATTTGAAATTTCAAATACTGCTAGTGGGGTTTCTGACTCGTGTT

TTGTTAGTTGCTCTCGTGTTAGTGCAGTTTAACTTTAGATATATTTTTAC

AGCTAGAGTTAGAATCGTCTGTAATTGAGTAGGCACTCGACGACAGTATT

GTTTAGGATAAAGTTTGATAAGCTCCGTTGCGTGTTAGAGGTAAAACGGT

GAGAATGGCTGGAACAGAAGGACCTCTGAAGgtaaattatattaacatta

tacaccacaattttcaccggatagcaatgcctttattatatttatgtaaa

agattagaaagaatatatgaatgcattagatgacaaatgttctaaaatgc

agaatattgtaaatgtgctccattatctaactttttacccaagtagttga

aatgtttaaacattaaagtgtaaagttacgttagcgttttattttccgtt

tatttgcgttattttttgtatttgcatgcatagatccgtcctaacgacaa

gttcaaaaagattcttccatcctaaatcctagcaacactaagttaccgtt

acagattataagttaccaag

hi3635 (3-5)

ttacggttaacgtatagcattcgggaattcaccaacctttttcatctaaa

aaagagtgtcaatcaaaagctttatttgctaagttatttggtttccccgt

ttttacgagtgtccccctctcagataaagattaaaacattctgtggtcgg

taacggtaacttactctggcttgtattagcgttgaggctaataacgttac

ttctaaatagcgaacagaaacgtttagggtaatgttagtttgtgagttat

tttaatcgtttaagttatgtcttttgtctttgaataaataatccaaattc

taaaatgctttctggcataacgttactaactgttactcactgtagtaaca

cttattaccctttgtatcgtgtttaaattataagtctggctgaatttacc

ttttgttaaatatccataacagttctaaataatttaaaaaatagtataac

aatatagcaaagagaaagacaatggctaagaataaaaaatcggtataaaa

taagagaggggcacataaaaaagtattaaagcacatatttagggaccgag

caccgaaacggtgcgtaggccctattggaattgctctgtttattagggac

cgagcaccgaacggtgcaaggccctattggaattgctccgtttattaggg

accgagcaccgaaacggtgcgtaggccctattggaattgctccgtttttt

attattattattattattattattattccgccccctatcggggcactttt

gagggtctaaacatgcccgaaaactcatgaaaatttgcacacacaccaaa

cccggtgtaaatagcaggttgatatgggtctctgaagtgggcgtggcaaa

atgactcga

 

unsure how far to next exon