polymerase (RNA) I polypeptide A

cDNA: Genbank BC055500

 

hi3639 is in the 5' UTR

 

tttgttcgttttccaaggtcaggatataccatctgaacaaacttataaaa

agccgtacttttacggccttgtataatattgatattgaggtgtttctccg

tgtataattaatacaaatgtctatgattttttttaggttaacgtcgatat

gttcattgcttttaatacgtgattgaatcttatttacctgtgcgtattaG

TTGGACTCTTTCGCTCTCCCAGAACACAGTCACACGTGTTTCATCTCTAC

ATGACGCACATGGGAAATACACACATAATTTATCTTTAATCTATATGTTT

hi3639 (3-5)

ATGCTTTGAAAATGCAATTTTCAAAAGAAACACCATGGAGGCGATTAGAG

GGCATGTCGTTTGGCCTGTTCTCCGCTGATGAAACAAGgtaatcttacac

ttccacgactttgctaaagaactaacgttagtcggagcagagacacgtta

aacgttaactaataaaaagaacatacagctcatttaactcgttaagctgt

ttgacaacaagccccatactctctcaccctaacattaaacataacgaact

gtcaaagtgtttgctaaaacatcccttcctgaaaaaaaaatgataacaaa

atataaacatttaaagaatttgtacttgttttcatgggttaaattacgaa

gcgtaattactttttttctgatttatggttgtccatctggtgtttaaaca

tggctttcattcgtggcatgtttaaatcacaaaatcctaatgtaacatgt

cttaagacatttgagaactactcaaatatactgattttaactgttaatag

ttgatggtgtgtgaaattttctgtggaaaccagttttccccctcagggaa

atttaaaaaatgtgcaagcaacaaagaattaaagaatcttaaacgtggaa

aacaagcaaagatgggttgaacatgatatttaatttaaaccagcaaaact

agatct