60S ribosomal protein L6

cDNA: Genbank AY648833

 

hi3655b is in the 1st intron, before the ATG

 

aaagcgtgtgtttctttaagagcaaaacatgccggaagaagaaccccgag

cgtaacacgtcacgactatatatacgtcaaatgcccggatgtcggtcttt

ttttctagttgaaggtaattgtggcttcCATGTCTGTTTTCTCCACACAC

AATCTGCATTAATCTCACTCATCATCGCGTTgtatgtcaatctatatcgt

atttaaatgctttaaaatattcatagcgctaatatctgtgaatattagtg

gacgtgttgcgtgttttagcgttcattatgagtgttcgccgcggaggcct

gacaaccgggtttatatgaacgctaacggcattttcagggcttatattta

cattaaacaccgttaaatcatacgcgacagcttatcatgagaacttaatg

ttaaataaacgttattatgacgattgttagtcttcagtgtgtaactatat

gttccgttagcatgttagcaatgctacatcgggtcacgttgagttaacgt

gctgtatgcagctactgtttatatatagtatagaaatatatgtatggttc

agattgtgtattgaatttcattagttttatattgtcaacagtttctgtgt

tcaaccgtttaactatgctttatattagcagtgtattttagaatatcaac

tcgaatattaatgaatggctttggtcaaattgctgaatttgtacatttca

gttcgggtatttaagggatagttcacacagaaattaacaaattccttcaa

atgtgtctaaactgcaatgaattttgtctgttgtacggtaaataagat

hi3655b (5-3)

aattgtggagtaatgttggaagaaaatagcaattctattggagtaaagtt

ggatttatactaataagttcagacttcatgtattttcagatgagttttct

tttcaaattctatattagggaaatcaaattagtagccagtcaaattacag

cattgttcagtcaattaaatggtgcttatgtggctttaaagtcacacttg

tgtgcaatttcagataaaatatccagcatttacaatatggagaccttctg

tttggcagctattttataaataacttaaatattaatatagaggtaaagtt

ggttttatatttgcgcattcgttcatttagaagtcttttgtttaccatgt

tactttaaatattcgatcggaattagcctgcaagtatgacttaacaacat

taacactttgactgcgaacagtgttatacttttttagtcattggctgcta

atatgatttcactatttagagtttgcaaataatacttttatgaaattgtt

attaaggggaaagtctgaatgtgtgaatataaaaccaactttatattact

ctttataacctctatattactaatatgttgtttataactgtacctaatga

taattaatcagcgttagcctttttaatttctgctttgctattttattgaa

tacagaatgtgctaatataaagccaacttgacctctaatttgacatttta

ttgtaagaacaaaaatacttttttaggtaaatggcatttttacttccttt

aaaatctatttaaaaaagttaagaactagtagagaattaattgatgacag

aatgtgcatttttctgtgagctgtccctttaatataatgcttctcaatgc

actaagcattgtctatttttctacatgtgcacattttaatgactatttat

tgtgcctagATGGCTGAGGGCGATAAGAAGAAGGTTGCCCGTAAGCATGG

CAGCCGTAACCCTGAGCTGGTCAGGGGCATCGGCCGCTATTCCCGCTCCG

CCATGTTCGCTCGCCGGGCCATGTACAAGAGGAAGACTAAAGCTCCAGTG

ACGAAGgtgcgtttttattttcatgatcagcatattgaagtgtcactcca

aatcagtgttttttt