chromosome 13 open reading frame 22-like

cDNA: Genbank AY648834

 

hi3662 is in the 4th exon

 

taatgacattttttaggggtacaaagggtaaaattgaactcataataatg

gtttaattattttccttaaaataacattagtttaaaagtgctccatgtat

ttactggggaggacacagacctggacatattgttttgaattttatatttc

ccaacatgattaattattctaatattgggctttattttcttattgaaaat

ttttttttctgataatgggctgaaataccagcaagctgaataaattcttg

atgagttttgtaaaatacgctattcatatttctgatcacattaggtgctt

gtgaatctttcttaaaaaattatccaagtgagatggtcatttacacccgt

gctgttatctcttatcttgcagTGCCTT

hi3662 (3-5)

TACCCGTTGGTTAGTAGATCTCTGGAAGAAGTGCGTGCTAGTTTATCCAA

AGGTGGATGCAAAAGGAGCATTTCTTCCCTTCCCGACATCAGTGATGACT

CCTGTCCTCCAAAACGACCCAGAGAAGAGAAACTGGATGTTCTGGCAGAT

GTTTCTGAGCCATGTGATGCTGAAGTCAATGATGCCACCCTTCCAGACGA

CACTGTCAAAACTCAAACGTTTACAGATCAACAGTCAGCACCTGCAGAGA

CTATTTCTCTTGATAAAACTGAAGAACAACCTGTTTCTATAGAAGACATT

AAGGAACAACCTATCTCTCATGATGCCACTGAGGGGCAACCTATATCTAT

TGATCAAACTGAGGAGCAACCCGTTTCTATTCTTCACACTGAGGAGCAAC

CTATAGTTCTTGATCTCATAGAAGTAAAACCTATGTCTGTTGATCATACT

GAGGAACAACCTATCTGTATTGATAACACCAAGGAACGACCTGTTTCTAT

TGTTCACACTGAGGAGCAATCCATAGTTCTTGACCTCATTGAAGTTAAAC

CTATGTCTATTGCTCACACTGAGGAGAAACCTACATCTTTTGATCACATT

GAGGAGAAGCCTATGTCTATTGCTCACACTGAGGAGAAACCTGTGTCTCT

TGTTCACACTGAGGATCAACATTTGTCTATTGATCAAACAGAGGAACAAC

CCATCTCAATTGATCCCACAGAGGAGCAACAACCCGAGGAATTACCTGCT

GTCTCTGATGAGGATGTAGACTTGTGTGAAAGGAAGGAGGATTGTGTATC

CAGTACTCAAGATGAGATGGAGGAGGAGGTCTTGGAGAGTTCTTCAGAGC

TGGTCCCGGTTCATTCTGAACTCTTCTGGAAAAACGAGGAGAACATGTGC

TGGTTGGATGCGATGTTGGTGATGCTGGTGCACTGCAGGACCATCAGAGG

GACTCCATGTCGGGGCATAAAGCTGAGCGATAAGTTGGCAACAGTGCCTT

GCAATGATTCTGTCGTCTGGAAACTTTGCTGGAGATATGATAAAACGTGT

GCCTATCTCCAAGCCAGGAAGAAACAGAGCGAAGgtaagaaaaagacata

tattggcatttgtacagtgtttgatttttgaccccctgattttgaaccat

ta