eukaryotic translation initiation factor 3, subunit 4 delta

cDNA: Genbank NM_200999

 

hi3663 is in the 2nd exon

 

atgtattacacactaggcaaaactgtccagccagagtctgggtggctgtc

tcccgctgcagtcttccgcaggcacagatggcgctgtagcgttgcgtgtc

CTTTCTCTTGCTCCCGTCCCGCGAAACGCTTCCTCTAGAAGCTCTAGACG

ACCCGCAAATATGCCGTCGATCGAATTCGACGAgtaagttttacatttat

gaaaccgtggagcttttttgtattcacagctggttaacagtcatctaatg

gcttgtgttttttgacagCTCA

hi3663 (3-5)

AAGCCTAGCTGGGCCGATCAGGTGGAGGAAGAGGGAGATGAAGgtacgag

gccgcagctcagcctgcgctcatacacacacgcacgtgttaaacagtctt

taattaatttacacttgttacataaagcgatatgaacacataccttacat

atgcagaaaacacactccttacggtaaatattgcggtcagtgagctcaat

gccatcttgactttagaaagcagatggtgctttgttatctttgttatctt

ctatgctacatcgagctataaagtaacttatacgttaatatactgtacat

atgcacgactgttaatatactatacttattctacgccatatttcacttta

acaatttactttgatgttgttctatgtcatactttaagttaacgttaagt

taaattaaagtagtgacatcagttaaagcttaatataaatcaataaccgc

tgttagatggcttattatactagt