ATPase, H+ transporting, lysosomal accessory protein 2

cDNA: Genbank BC059542

 

hi3681 is in the 1st intron

 

ggtggcagtcgaagcagactgagggaaatgttgttgcgtcatgacgcacg

acgtcacgcggctggccctggtcatgtgactggtgttgcgaggaaGCGCA

GTCCATCAGAAAATCGTCCCGAGATGAATCGAATAATTATGAACGCCGTA

TTTGCCCTTATAGGACTCTTATCAGgtaaattgactttatatttggtctt

tgacgtgtacgtcgtgttgttttatagggtccagggggttttagcgtgtg

tttaatgaattaatggcggctgcagtgggatgccataatccgcagtcatg

tcattcgattaaatatctccgttatcaatgttat

hi3681 (5-3)

cctgttaattcaagagtatttggaaagatattgtgtgtgtggggcactcg

gctgttaaatacaaaggggtgtagtgttaaatgttgatcgtgaatgagga

agcccaagcgggtcatgtgacagtcatggtttatttaacaaatcctacat

ttctaatcaatattatacttatgatagaaattaagcttatgtatttgtgt

tttttatactacactaaatttcaatggggtatatgacactggacacccaa

atctgataatttcggtgcctcctaaatgtgaactgcggatattaatgcgt

gttttaaaacctaactcagaataatttatattaaaaaatatatatttaaa

atatttgtgggctatttagtttcaataatgtttatttagctatttctatg

cattatagtgctgtaatgtttgattcttctgatttatataatttacaatt

tcaactgcttttttacttatttgctttgtaatattatttttcatttgttt

atattgactttcatgaagtcctgcttgaatacagatgttttaatgtactt

aaaacacacacaaaatgtcattgcgaggtcattagatacagaaatgtcaa

agcgattgtcatttaattccaataaagattatgaaaatatgtgaaaattg

atttcttaattttctgtcagGTGTTTTGGGGGACAGTTTGACAGTTTTGC

GAAGCCCTCAGTATGTGACTTTTCGGGATGAGCAGTGGCCCATATCGGGT

GAAAAGATCCCAGATTTAGTTGCTCTGACCATGGGCTTCTCTGTTCGTGA

Ggtattatgtctgtttttttatttttcttatttgttgtaatagcacatat

gatgtcttaatgtaaacactgtgataaacttgattttttaaaatcttgca

gGATCTCGATTGGCCAGGTCTGGCTGCCGGTTCACTGTTCCAGCGTCCTC

GTGCTAACGCTCTAATCGTTGTGCGTGGCATCGACAGCCTGGACTTTCCA

AAAAACGTGTCCTCTTACCCTCTCGAAAATgtgggtgacacattctcaca

tgctggatttattttatgatgtgtgttgtgcgttgttttgtctggccttt

tactgatctttgactcactttgcagtttaccagaaactattgagtaaaga

taaataactccctttagaaccggaaaatgggaagcaatgttcatcagcta

tatttgtaagttttagaattgagcagcagtgtagtttcccctccagactt

ccccattttatatcatgagacataagacgcttttatctatat