dynein cytoplasmic 1 heavy chain 1

cDNA: Genbank DQ323903

 

hi3684 is in an intron, ~70% the way into the coding sequence of a very large gene

 

ctacagctttcctcatgagccatggctgtgttcaaaataacataaatgtg

ttcagtgcactgtgaagggagcacaactgtcaacatgaagatggctaaac

tgaactggagaaatggtctgaaagcagatcaccctgagagagaggagcgc

actgctgcccttaaccatgcagagtataaatatagagcaatagggcatag

gggggataacggggaatgggacacagccaggaactgtttctaactacagc

tgtagaggagcagctgccagtgcacacgtttgtgacgcagtttgcgaatg

ttcgtcagagtgttggatttgggaaacactaaattaatgaaccgtgtgtg

taacgacggaacgcaagagctggctaaccatggacacggagaacactcta

gccctgttatatgacaacagctcactgatcctggatcagggcaaaccggc

aataactgaacccagctaatgaagagcagacccctgatctcacacacaca

cacacacacacacgctctctcagctggactctgacacactctttacacac

acagCGACTCCATCCGGGAGAAGATGAAGAAGAACTACATGTCCAACCCC

AGCTACAACTACGAGCAAGTCAACCGCGCATCGCTAGCCTGCGGACCCAT

GGTGAAGTGGGCCATCGCTCAGgtacacacacacacacacacacacacac

acacacacacgcctacggacccatggtgagtgggccatcgctcaggtaca

ctctctctctctccctctggtgttgactgtgtgtgtgtgtgctgcgcgt

hi3684 (5-3)

gtgtgtgtgcgtgtgtgtgtgtgtagCTGAATTACGCAGACATGCTGAAG

CGTGTGGAGCCGCTGCGTAACGAGCTGCAGAAGCTGGAGGACGACGCTAA

AGACAACAAGACCAAAGCGGAGGAGGTGGAGCAGATGATCCGCGACCTGG

AGGCTAGCATAGCACGCTACAAGGAGGAGTACGCCGTGCTAATCTCTGAG

GCGCAGGCCATCAAGGCAGACCTGGCGGCGGTCGAGGCTAAGgtaccagc

gccacgttcatg