polymerase (RNA) II (DNA directed) polypeptide G-like

cDNA: Genbank BC045299

 

hi3685 is in the 2nd intron

 

aaaataaaattctgaatccagaatcaacgcacactaaactagcagggact

ttatttctagggaatcttagggcttttaatttgcagtcgttttcacccgg

AAACATTCGCGTGCTCGCGCTGTCGAGATTCGGCGCCTGAACGCACTGAC

ATAGAAAGTCGTGGCTGTAGAGTTTTAATTCAAGACTTTTGGAAGCTAAA

ATACAATAAGAGATGTTTTACCACgtaagtcagtgggtgttttagtttta

cgtgataagtgagttgcagcacttataaatgtccgtcaatgttttctgtg

ctcactgttgtttacacgttgtttgtcacaatagATCTCTCTGGAGCATG

AAATTCTCCTCCATCCAAGATATTTTGGACCCAACCTTTTGAACACAGTC

AAACAGAAACTGTTCACTGAGGTTGAAGGAACATGTACTGGAAAgtaagt

taacgttacttcatcaataaatgaatgaacgttatgagatctgactctct

hi3685 (3-5)

aatgctcgtgtgttgtttcccagGTATGGCTTTGTTATTGCAGTAACCAC

AATCGATAATATTGGAGCAGGGGTTATACAGCCGGGCAGAGGTTTTGTGT

TGTATCCCGTCAAATACAAAGCCATCGTCTTCCGTCCCTTCAAAGGAGAA

GTTGTGGATGCTGTTGTCACTCAGGTTAACAAAgtacggtttgtgttttt

attttcatacaacagttacaaacatatacaacagttacaaaaatataaat

ataaaatatacattatatagaacatcagtacgggataattaatacttatt

aaaacaataatgctcaaacaaggtgttgtgtacataattttgtattttct

aattgttcaataaactggagactattattgtgcttatactatggttacta

gacataaatgttcaggtcagatgatttaaatcgagacatttttcagattt

ctgtcctcagacagctcacgtgtgtaatacttatgtagtgtcaaaattat

cttagccaaagcctttagttttgatttttaaatgtgaaataactgtaacc

attcatcgtagtgatgtggaactaatgcagtcaagacctgcctggaactg

cgaaagcagtgtgcttatttaaaaataattgaacaccttaagtttcacca

gccaatcaaaatcaagccctgtagtataattacctttattccacaccctt

ggcaaatggtcctcagagcttttatataggcataaggtggtatcagattt

tctagttgtgataattactgaagcttttatcacaatctatggcattctca

aaatattgacttaagcagttataaattagttttaataacaaataaacact

acattttgtgtattgcacttaaatgttcacagttgaccaattttcctagc

aaaataaactgaaaagt