hi37 gene

cDNA: Genbank AY648708

 

hi37 and 2911b are both in the first intron, before the ATG

 

agatctctttggaagggcactttctatccaagactaaatagggcatgtgc

actgcacaggttgagccctgtgtgtgcacgtgcctgacaaaccccctata

tataatgctgtgcaggaacaaaagaatgctaatttgtattttaatgttgt

caattcacattattccaatcacttgaaaagtatatcttcaatgcaatgaa

gtccatgtagtcaaataccaacttctaggcataggacaagtgaacgtaat

taaaagtgtccatgctatcttatttaaaccaagttatgtaatagtctgga

gtaacaaagggagagagagagagagacaaacggtacaacagctgaggttt

tagcactgggcaaatgttggtaacgttaggcctatttttaattcccagtc

tattttgagaatttataatttttgtatatgatttatgcattttacccaaa

ccagtatctaatactgaattaatgattaacactgttaaatatacgtgcta

aaaatattataacatactaacaaagcaacgatatgggcggagtcgacaat

aatcctatcctagtcagttcctgtcccagtctggtcgtgaacgcgcccca

tTCAGGTGACGTCACGGCTGCAGCTGTTCAGTCGGTGTGAATGTAATTTC

ACGGACACCACTCGTTTTTTTTCGACGGAGAAACCTAGATGTGACGACGA

AAGCGACGGAGTGTTTGTTTTTTGGAAACGTTTACGGTTCTTTTTTGGTC

AGATGTGGACCGACGCTTAACAGAAGACGTTTGTTTGCTATCACGGCCTA

TCTGTTTTCAGTATCGTGCTACATCGGgtatgtcaaaacaactcagccag

tcaacttcgtcggattttagtaa

hi2911b (5-3)

cgtagacatttaacagtgaaaagatta

aacgaattattagcataactgatattgttgcatagcactgtagtgaaaat

ggtttcgctttgtcgtagtttcgcattagcgcgataaacgaaggagtgtt

gttttgtgcgatgtgtttttacatttacacgta

hi37 (3-5)

ccgctaatgttgtttctattgtcttagaagtgttgttgcattatctgtgt

aatgttactagtgaaacgtcgtgctggtacatttgtttcgagttagcatt

ttggatgtgactcacggccttgtcggcccagacacgcgttcatgtaacat

taggccaggaatgtggtgtcgtcgagctcggttcattcactgacttttaa

catgatttaattaaggtcgtggaaaactactaaaacttgcatgttagttt

gtttcatccagtcaccacgtctctggcaaacacattctgtgattttattt

gtatggacttcctgcagtgtcgtactgtattgtttgtttaaaaggggttg

aaatgcattgtagaaacggtaacgttacatgtcctcaaacgttttaaata

gcacacacactctccgaggagcatgaaacgttttaacttttgttacattt

tcaaagcactgacacgttaagattgattgcttggatttttttgtatggac

ttaaaattatgtgaagtattattgcttattaattataagaacttttttgt

gttataattttttgttttattttcagatactacaaccttaagtcaatatt

tcttattttttcgcaattatttatatttgtattgtttttttgtacgtgag

gcatgttgcattaccttaactggaagattaatatttaatgtcttttattt

cacttgaagATAGGTGATAAAACTGAAAAAAAATGGTGAGACCACAATCA

GGATCTCCTCGTTCCAAACACAGgtttgatttagaaatgtaataaacaat

tctgattgaactataagtttatcattataagtgagactaaaatgttgttt

attctcatacagGCCTTTCTCAGACAACTACAATAGCATGAATCATGAAG

GGCGATATGGCCCCCCTTCAAGAAGCCAAAGAGGTTTCAGAGGGCCTCCT

GGAAAAGCCCCTCCGAGTTGGAGAGTTCACAACAGTAGTGGATCCCAGCC

CTACCCCAAGAGGCCTTCCTCACTCATGGGTGAACGCAGAGAGCGACCAC

ACGGACAGTGGATGCAGAACCAGGATCACTTCCATCCGTATCCCAACTCG

CAGGATTCACAGAGAGGCCGAAGGAGGCCATCACCACCCCGCTCAAGTCG

CCCTCCCCCAGTACAGCACAGGCAATCCCCTCATACCTCTATACATGGAC

CGCCTAGCCACAGAGCACCAGTATTCCATGGAAACCACCCTAGACACACA

TCTCCATCTAGACACGGATCTTTTCATGGCCCTCCATCAGATCGACGGAT

TCCTTCACCTCATAATTCCTTCAGGGGTCCACAGCGACGCCCAAGCCCTC

AGGATCATGACAGGAGCTGGGGTCCCACTCCCCGGGAGAGGCCTTTTGGC

CGACCAGCACTTGGTGGGCACCACTGGAATGGCCCAGGAGGTTACCCTCA

TCCCCACAGTGGGGATTCGAGGTTCCCTGGCCCACCCCACAGAAAGCCCA

GAGAATTTCATGGAAGGAGTTCATATCCAGAGAGgtacacaaatgaagct

gtacaagctgggtaatttaattatacaattatgtgttagtttgcgaagtc

aagtacacactgcagggtggtgagagtaaatcccagctgccttcagcttt

ttgtcactgtaaagtaccacaggatctaataataaagcccctaaagtcaa

acagtctgtctggagaaaatgtaaaaaccatttgaggcatttcccactta

aagtaataccaccacagaagtgatatggcattcagtagcctggggctgga

tctaaattaatagaagttaagagcttccacacagctcaagctgcacaaac

tggcattataaccaacatgtttgtattgtttgtaatggatatgtagGTGG

TCTGCAGAGAGAGATCAACGTGCACCGCATGGAGACCTTAGAAGGGATGT

TCGGCGCCCCAGCATGGAATTTGCACACAGAGGAGGAGGCAGTCCACACT

CTCGGCCCCCTTACAGATCACCAGCACGAAGACCTGGCCCACCCCCACCT

GGCTCGTCGATCAGACCTTATCCGCTTATGCGACTACAAGACAGGCAGAT

TGGACGACCAATGAAGAGGAGGAATCAAGATTTCAGACGGCCGCCTCCAC

TTAGCAGTTTGGAGCATGGGCCGCCAAAGCGTTTCCGCAGGGAACTGTCT

GTGAGACCTCTTCCTCTTCGGGGCTTCAGAGGTCGTGGTTTGACCCTTGT

TGATAAGAGTCGACTGCTTAAGGCACGGAGGTTCAGAGCAGAGTCGGTGA

CGCAGTTCAAACTCCCACCACCAAGGCCAAGATTATCAGACAGAGTCCAG

AAACCCAAGCCTCAGACAACACCAAAAAATGGCAAAGATTCTTCAGGAGT

GCCACTACGCAAGATGCCACTCAAAAAGATGCCATCATCTAGAGAGTCAT

CCCCCAACACCGACTCCAAGACTGCAGTTGCTGAGAGGGACTCTGAATCA

AAGGTGGAATCCCGTCGCTCTGAGAGCGCACACAGgtatggtatcacccc

tcacattgtggcaatgggcgcgtgatgtttagaaggtcaagcttcctgtt

ttacaatggcacaactttcaacaaatgggtgtcacctgaatgatgaaatg

gatgagagaaaaaaagaaaatcatgcctgttttcctcattattttcaaca

gtatgatgttaaacctgtcattgtccagaatacttctgtcctcaacaaga

gaatgtgataagagataagcaagtctttcaaaagtcttttttttttaacc

aaaagtcacatgcagtttgttccatgatgcatcctccacatcgactttga

tccaaaagggatgattaaagtttctttcggtgagggaaatggtttttaat

ccttattcttacgtttttgctgaaggaaagtctgtcatgatatacctaca

atgttctgccgcagtatgcagctcactgcagtaacgcaagcacaaatcaa

tctcacaactgtggggcatggacagtgcataggaatttcttggaaatgga

aatatttcaatggacttaaatggagaagaattttacacagcagagcattt

tcaacattgaaatactgctgatatgtcttatcaagttgtaccctctgaag

aattgacatgattggctggatgaaggaaacagattgactctgtggctgga

aatcagattaagaacaaaaataactccttttataaaggcatgtacgttta

cctaatagatgttgaaagattttgtcagcatctaataagatgaccatttt

ccaaaaatcaatacccaataatcatagtaactttttgtaacaagaggcct

cttcaagtaagaaccacgatgagaaagaagacttgcattcatgacagatc

t